[JackSpratts]

The End of Privacy
Elliot Cohen

Amid the controversy brewing in the Senate over Foreign Intelligence Surveillance Act (FISA) reform, the Bush administration appears to have changed its strategy and is devising a bold new plan that would strip away FISA protections in favor of a system of wholesale government monitoring of every American's Internet activities. Now the National Director of Intelligence is predicting a disastrous cyber-terrorist attack on the U.S. if this scheme isn't instituted.

It is no secret that the Bush administration has already been spying on the e-mail, voice-over-IP, and other Internet exchanges between American citizens since as early as and possibly earlier than September 11, 2001. The National Security Agency has set up shop in the hubs of major telecom corporations, notably AT&T, installing equipment that makes copies of the contents of all Internet traffic, routing it to a government database and then using natural language parsing technology to sift through and analyze the data using undisclosed search criteria. It has done this without judicial oversight and obviously without the consent of the millions of Americans under surveillance. Given any rational interpretation of the Fourth Amendment, its mass spying operation is illegal and unconstitutional.

But now the administration wants to make these illegal activities legal. And why is that? According to National Director of Intelligence Mike McConnell, who is now drafting the proposal, an attack on a single U.S. bank by the 9/11 terrorists would have had a far more serious impact on the U.S. economy than the destruction of the Twin Towers. "My prediction is that we're going to screw around with this until something horrendous happens," said McConnell. So the way to prevent this from happening, he claims, is to give the government the power to spy at will on the content of all e-mails, file transfers and Web searches.

McConnell's prediction of something "horrendous" happening unless we grant government this authority has a tone similar to that of the fear-mongering call to arms against terrorism that President Bush sounded before taking us to war in Iraq. Now, Americans are about to be asked to surrender their Fourth Amendment rights because of a vague and unsupported prediction of the dangers and costs of cyber-terrorism.

The analogy with the campaign to frighten us into war with Iraq gets even stronger when it becomes evident that along with the establishing of American forces in Iraq, the cyber-security McConnell is calling for was, all along, part of the strategic plan, devised by Dick Cheney and several other present and former high-level Bush administration officials, to establish America as the world's supreme superpower. This plan, known as the Project for the New American Century, unequivocally recognized "an imperative" for government to not only secure the Internet against cyber-attacks but also to control and use it offensively against its adversaries. The Project for the New American Century also maintained that "the process of transformation" it envisioned (which included the militarization and control of the Internet) was "likely to be a long one, absent some catastrophic and catalyzing event -- like a new Pearl Harbor." All that appears to be lacking to make the analogy complete is the "horrendous" cyber-attack -- the chilling analog of the 9/11 attacks -- that McConnell now predicts.

Apparently, the Bush administration had hoped to continue its mass surveillance program in secret, but as many as 40 civil suits were filed against AT&T and other telecoms, threatening to blow the government's illegal spying activities wide open. Unable to have these cases dismissed in appellate court by once again playing the national security card, the administration drafted and tried to push through Congress a version of the FISA Amendments Act of 2007 that gave retroactive immunity to telecom corporations for their assistance in helping the government spy en mass on Americans without a court warrant. The administration's plan was to use Congress' passage of this provision of immunity to nullify any cause of civil action against the telecoms, thereby pre-empting the exposure of the administration's own illegal activities.

Two versions of the FISA bill emerged, one from the Senate Intelligence Committee drafted largely by Cheney himself, which contained the immunity provision, and another from the Senate Judiciary Committee that did not contain the provision. Although Senate Majority leader Harry Reid inauspiciously chose the former to bring to the Senate floor, the bill was surrounded by much controversy. There had been well organized grassroots pressure to stop it from passing, and the House had already passed a version that did not include the retroactive immunity provision. Thus, in the face of a filibuster threat by Sen. Chris Dodd (D-Conn.), Reid postponed the discussion until the January 2008 session.

Now Reid has tried to put off the FISA Amendments Act once again by asking Republicans to extend, for one more month, the Protect America Act of 2007, an interim FISA reform act that is due to sunset in February. However, Cheney has urged Congress to pass his version of the FISA Amendments Act now. "We can always revisit a law that's on the books. That's part of the job of the elected branches of government," Cheney said. "But there is no sound reason to pass critical legislation … and slap an expiration date on it."

Cheney's point about the possibility of later revisiting the FISA Amendments Act after it becomes law may foreshadow replacing it in the coming months with a law based on McConnell's plan, which is due to emerge in February. This would mark a gradual descent into divesting Americans entirely of their Fourth Amendment right to privacy -- first by blocking their ability to sue the telecoms for violating their privacy and then by giving the government the same legal protection. After all, the FISA Amendments Act still requires the government to get warrants for spying on American citizens even if it does not afford adequate judicial oversight in enforcing this mandate. McConnell's proposal, on the other hand, would make no bones about spying on Americans without warrants, thereby contradicting any meaningful FISA reform.

President Bush has already made clear he would veto any FISA bill that did not give retroactive immunity to the telecoms. However, if McConnell's soon to be unveiled spy-at-will plan is turned into law, a separate law giving retroactive immunity to the telecoms would be unnecessary. All Bush and Cheney would need to do to protect themselves from criminal liability would be to make the new spy-at-will law retroactive in effect from the inception of the illegal NSA surveillance program. This would also be sufficient to deflate the civil suits filed against the telecoms because the past illegal spying activities that these companies conducted on behalf of the government would then become "legal." Indeed, the Bush administration has already done this sort of legal retro-dating and nullifying of civil rights and gotten it through Congress. For example, the Military Commissions Act of 2006 conveniently gave Bush the power to decide whether someone -- including himself -- is guilty of torture, irrespective of the Geneva Conventions, and it made this authority retroactive to Nov. 26, 1997.

Whatever the final disposition of FISA in the coming weeks or months, the administration is now bracing to take a much more aggressive posture that would seek abridgement of civil liberties in its usual fashion: by fear-mongering and warnings that our homeland will be attacked by terrorists (this time of the menacing hacker variety) unless we the people surrender our Fourth Amendment right to privacy and give government the authority to inspect even our most personal and intimate messages.

It would be a mistake to underestimate the resolve of the Bush administration. But it would be a bigger mistake for Americans not to stand united against this familiar pattern of government scare tactics and manipulation. There are grave dangers to the survival of democracy posed by allowing any present or future government unfettered access to all of our private electronic communications. These dangers must be carefully weighed against the dubious and unproven benefits that granting such an awesome power to government might have on fending off cyber-attacks.
http://www.alternet.org/story/75133/





Missouri Governor Urges Lawmakers to Pass Internet Harassment Protections

Missouri Gov. Matt Blunt today called on members of the General Assembly to quickly pass recommendations presented by his Internet Harassment Task Force.

"I created the Internet Harassment Task Force to help protect Missouri families from the terrible tragedy that Megan Meier's family has had to endure," Blunt said. "I applaud the bi-partisan legislators, law enforcement officers, child services advocates, Internet providers and Missourians who worked together to define valuable recommendations for our state and call on lawmakers to quickly pass legislation placing the recommendations in statute."

The governor's task force, headed by Public Safety Director Mark James, identified several recommendations to enhance Missouri law and protect public safety. Among their recommendations is ensuring cyber bullying and harassment is clearly defined in state statute and offenders are punished accordingly.

In addition the group recommends criminalizing the use of any electronic device -- which includes computers and text messaging on cell phones -- for the harassment of another person. Legislation the task force drafted calls for penalties ranging from a class A misdemeanor to a class D felony depending on the circumstances surrounding the offense.

Sen. Scott Rupp is sponsoring legislation that includes the task force recommendations. The Senate Judiciary and Civil & Criminal Jurisprudence committee held a hearing on the legislation yesterday.
http://www.govtech.com/gt/articles/259919





The Dangers of `Locking Down' the Internet
Michael Geist

As digital technologies and the Internet began to emerge in the mid-1990s, many content companies responded by betting on the ability of technological protection measures to re-assert the control that was rapidly slipping from their grasp.

The vision of control through technology required considerable co-ordination – the insertion of encryption on content distributed to consumers, co-operation from electronics makers to respect the technological limitations within their products and new legal provisions to prohibit attempts to pick the new digital locks.

A decade later, the strategy lies in tatters. Many content owners have dropped digital locks after alienating disgruntled consumers fed up with their inability to freely use their personal property.

Electronics manufacturers have similarly rebelled, frustrated at the imposition of artificial limitations that constrain their products and profitability.

To top it off, the U.S architect of the legal strategy last year acknowledged that the legislative initiatives to support the digital lock approach have failed.

In recent months, a new strategy has begun to emerge. With the industry gradually admitting that locking down content does not work, it has now dangerously shifted toward locking down the Internet.

The Internet locks approach envisions requiring Internet service providers to install filtering and content monitoring technologies within their networks. ISPs would then become private network police, actively monitoring for content that might infringe copyright and stopping it from reaching subscribers' computers.

The support for locking down the Internet revives an old debate – the appropriate role and responsibility of ISPs for the activities that take place on their networks. As the content owners were promoting legal protection for digital locks in the 1990s, the ISPs were supporting legal frameworks that treated them as the equivalent of common carriers that transferred data across their networks without regard for the content itself.

While that approach ensured that ISPs did not take an active role in monitoring or filtering Internet-based activity, the recent move toward a two-tiered Internet – one in which the ISPs themselves dream of distinguishing between different content as a new revenue source – revived the notion that ISPs could be called upon to play a more active role in monitoring and blocking content.

With content owners frustrated at the failure of digital locks, last year they seized on this by renewing their focus on the role of the ISP. This movement has been most prominent in Europe, where last summer a Belgian court ordered an ISP to block access to a site alleged to contain copyright infringing materials.

More recently, French President Nicolas Sarkozy unveiled a plan that would mandate country-wide ISP filtering of copyright infringing content. Although a similar pan-European proposal was defeated earlier this month, few believe the issue is dead, particularly given the International Federation of the Phonographic Industry's claim last Thursday that 2008 will be the year of greater ISP responsibility.

Content filtering plans have also begun to emerge in North America. Large U.S. ISPs such as AT&T have inexplicably promised to develop new content filters on their networks and are discussing an implementation plan with content owners.

Could a similar content blocking approach wind its way north?

Late last week, the Canadian Recording Industry Association stated that it presently is not seeking provisions "related to content filtering or termination of repeat offenders."

That provides a measure of reassurance, yet some cultural groups are openly eyeing content filters as a mechanism to adapt Canadian content rules to the online environment, while others have expressed strong support for legal rules that force ISPs to accept heightened "responsibility" for the conduct of their subscribers.

In light of this pressure, some fear that mandatory content blocking could sneak into forthcoming legislation, despite the likelihood that such laws would face constitutional challenges and run the risk of tarring Canada as the home of a censored Internet.
http://www.thestar.com/columnists/article/297938





Scientology Writes; Gawker Rises
Andrew Adam Newman

“If Tom Cruise jumping on Oprah’s couch was an 8 on the scale of scary, this is a 10,” Nick Denton wrote on his media and gossip Web site Gawker.com on Jan. 15, when he posted an internal Church of Scientology video in which Mr. Cruise rhapsodizes about his religion. The page has been viewed over 2.3 million times, a record for Gawker.

At Scientology’s request, YouTube and other sites took down the copyrighted video, but Gawker refused, instead posting and mocking the reproachful letter sent by a Los Angeles lawyer representing the church.

As for whether Gawker will be hauled into court, Karin Pouw, a spokeswoman for the Scientologists, issued a statement that further action had not been “contemplated, let alone decided.” Equating the lawyer’s letter with a threat of a lawsuit amounts to “unsubstantiated rumors” by “those wishing to create further controversy and media attention,” she wrote.

Diane Zimmerman, an intellectual property professor at the New York University School of Law, said Gawker appeared to be within the copyright law’s “fair use” provision, which permits excerpting copyrighted material for news gathering or criticism.

The Church of Scientology, founded by the science fiction writer L. Ron Hubbard in the 1950s, also figures prominently in an unauthorized biography of Mr. Cruise by Andrew Morton, which calls Scientology a cult. Published by St. Martin’s Press the same day Gawker posted the video, it was the 25th-best-selling book on Amazon.com on Sunday.

The timing of the imbroglio has been fortunate for Gawker Media. A Gawker editor, Choire Sicha, and two other bloggers resigned last month, and several articles in print publications, including The New York Times, have examined whether Gawker’s relevance and popularity were waning.

But according to the Internet tracker Site Meter, unique visitors to the six-year-old site more than doubled, to more than 13.6 million so far this month, from 6.7 million last January, because of popularity of the posts related to Mr. Cruise and to the actor Heath Ledger.

Some former Gawker bloggers have criticized a new compensation system that on top of a base rate pays $7.50 for every 1,000 views that posts generate. If one of Mr. Denton’s bloggers had posted the Tom Cruise video, his or her haul thus far would be more than $17,000.

In an instant-message interview, Mr. Denton, who replaced Mr. Sicha with himself as editor, wrote, “Unfortunately, I don’t get page-view bonuses.”
http://www.nytimes.com/2008/01/28/bu.../28cruise.html





Radio Host Uses Copyright Lawsuit to Silence Muslim Critics; EFF Fights Back
Nate Anderson

Michael Weiner has a radio show. For obvious reasons, he has chosen to do the show under the name Michael Savage instead, and "The Savage Nation" attracts a few million listeners per week. They listen, in part, to hear Savage rant on conservative topics. On October 29, 2007, listeners were rewarded with this bit of enlightened monologue on the topic of Muslims:

What kind of world are you living in that you let them in here with that throwback document in their hand, which is a book of hate. Don't tell me I need reeducation. They need deportation. I don't need reeducation. Deportation not reeducation. You can take CAIR and throw them out of my country. I'd raise the American flag, and I'd get out my trumpet if you did it. Without due process. You can take your due process and shove it... Wherever you look on the Earth there's a bomb going off or a car going up in flames, and it's Muslims screaming for the blood of Christians or Jews or anyone they hate.

There's more... much more (Savage believes that "90 percent of them are on welfare," for instance), and it's not surprising that the Council for American-Islamic Relations (CAIR) might have a different view. CAIR posted a four-minute excerpt of this show on its website along with a rebuttal, and Savage then filed a lawsuit against the group, alleging copyright infringement.

Savage's legal filing stands in a class by itself. Little of the filing talks about copyright at all; the vast majority is an extended rant about "CAIR and it's [sic] terror connections" and how the group was "tied to terror from the day it was formed."

Savage isn't just upset about copyright; in fact, he complains at one point that his remarks were taken out of context and that many other selections (i.e., more copying) from his show would indicate his regard for Muslims. Savage is upset that CAIR used the clip to convince some advertisers to pull their support for his show, a practice he seems to think is illegal.

He also makes a racketeering claim against the group and says that "the role of CAIR and CAIR-Canada is to wage PSYOPS (psychological warfare) and disinformation activities on behalf of Whabbi-based [sic] Islamic terrorists throughout North America. They are the intellectual 'shock troops' of Islamic terrorism."

The EFF has now stepped into the debate (Savage refers to them as "liberal attorneys"), helping to prepare CAIR's response. The response, filed on January 30, takes issue with Savage's "172-paragraph legal broadside laced with falsities and xenophobic fantasies to punish and intimidate the Council for American-Islamic Relations." Their point is a simple one: as a matter of law, the US allows anyone to use copyrighted material for the purposes of criticism or commentary.

"Fair use" law in the US is based on four general tests that give fair use its elastic character. But copyright law also contains several specific exemptions, including the one for criticism. The EFF runs through the four factors: purpose and nature of the use, the nature of the copyrighted work, the amount used, and the effect of that use on the value of the copyrighted material.

The EFF believes the lawsuit was a brazen attempt to "use copyright law to punish a vocal critic," and the group points out that using copyright law to stifle dissent has become a common practice against critics on either side of the political spectrum. Michelle Malkin was treated to a DMCA takedown notice last year, for instance, after using clips of the performer Akon in a critical video post.
http://arstechnica.com/news.ars/post...ghts-back.html





Can a Sandwich Be Slandered?
Louise Story

Some companies have made a sport of using advertising to bash a competing brand: Pepsi and Coke, Colgate and Crest, Miller Lite and Bud Light.

It was a rivalry of this sort that compelled Quiznos, the toasted-sandwich chain, to invite the public to submit homemade commercials in a contest intended to attack a top rival, Subway. The contest rules made it clear that the videos should depict Quiznos sandwiches as “superior” to Subway’s.

Subway promptly sued Quiznos and iFilm, the Web site owned by Viacom that ran the contest, saying that many of the homemade videos made false claims and depicted its brand in a derogatory way. Subway is also objecting to ads that Quiznos itself created, showing people on the street choosing Quiznos over Subway.

The dispute over an ad is fairly standard — companies often sue one another over advertising claims — but the video contest raises a novel legal question: Quiznos did not make the insulting submissions, so should it be held liable for user-generated content created at its behest?

If the answer is yes, that could bring a quick death to these popular contests, advertising executives say. Consumer brands like Doritos, Dove, Toyota and Heinz have run promotions of this sort because they generate publicity, usually at a low cost to the advertiser, and sometimes lead to clever spots that work well on television. But the Subway lawsuit, which seeks financial and punitive damages, seems to open a Pandora’s box.

“Let’s just hope that as collateral damage it doesn’t kill the entire genre of competitive advertising,” said Brad Brinegar, chief executive of McKinney, an ad agency in Durham, N.C., that does not work with Subway or Quiznos.

In its lawsuit, Subway contends that the consumer videos — which were posted at a site Quiznos had set up called meatnomeat.com, as well as on iFilm — contained “literally false statements” and depicted Subway in a “disparaging manner.”

Subway asserts that “the contest rules, the promotion of the contest on the Quiznos meatnomeat.com and iFilm Web sites, and the use of the videos were all part of an organized campaign to penetrate the market in which Quiznos and Subway compete.”

The case is scheduled to go to trial in federal district court in Connecticut in 2009. The plaintiff is Doctor’s Associates, the franchiser of Subway, and the defendants are iFilm and QIP Holder, a subsidiary of the Quiznos parent company that owns the Quiznos trademark.

Subway and iFilm declined to comment for this article. A lawyer representing Quiznos said the company had no involvement in the creative aspects of the consumer videos.

“We’re just facilitating consumers who go out and create their own expression in the form of a commercial,” said Ronald Y. Rothstein, a partner at Winston & Strawn, on behalf Quiznos.

The contest, called the “Quiznos vs. Subway TV Ad Challenge,” was held in the fall of 2006. About 115 videos were submitted by consumers, and all were viewed by Quiznos or iFilm before they were posted to the meatnomeat.com site, which has since been taken down. Some consumers also posted their videos on YouTube of their own accord, and those videos remain there.

The winning video showed two young men racing down a hill in wagons. The Quiznos vehicle is shaped like a meaty sandwich, and its driver blasts the plain-looking Subway car with smoke, causing it to topple over in defeat. Its creators won $10,000, and their video was shown on VH1 and on a giant screen in Times Square on New Year’s Eve in 2006.

But Quiznos was already aggressively comparing the meatiness of its sandwiches with Subway’s in its professionally made ads — which are also part of the suit — when the contest was announced. According to the rules, submissions were meant to draw “a comparison between Quiznos and Subway with Quiznos being superior.”

One of the videos showed a Subway sandwich running to a Quiznos store to find more meat. Another showed two submarines fashioned as sandwiches, with the one representing Subway being obliterated because it did not have enough meat, according to the suit.

Among the videos that can still be seen on YouTube, one shows a wife arriving home with a Quiznos sandwich for her husband and a Subway sandwich for her dog. In another, a young man runs through town to find a sandwich, passing by seven Subway stores before he reaches a Quiznos and goes in. In a third, two men punt sandwiches across a parking lot; the Subway one soars high but the Quiznos one is so heavy that the man falls over when he kicks it.

From a corporate perspective, one of the attractions of these contests is that the general population has more leeway to make videos that cross into murky territory. Consumer ads are sometimes offensive and crude, and they often exaggerate the benefits of the products made by the company that dangles the prize money. The sponsor can try to distance itself from the provocative content, while at the same time benefiting from the attention the videos draw to the brand.

The Subway/Quiznos case hinges on how the District Court of Connecticut interprets two federal laws: the Lanham Act, which dates to the 1940s and centers on trademark rights, and the Communications Decency Act, which was passed in 1996 to safeguard the Internet. If Subway wins, advertisers and media companies may find themselves liable for false advertising claims made by consumers who participate in their contests.

Last spring, Quiznos and iFilm tried to claim they should not be liable for user-generated content because of the Communications Decency Act, which immunizes “providers” of “interactive computer services” from responsibility for user postings on their sites.

That provision protects YouTube, for example, from liability for consumer videos on its site and AOL for comments in its chat rooms. But it is not clear whether Quiznos was an uninvolved provider along the lines of a YouTube or AOL. The judge in the Quiznos case ruled she could not dismiss the case simply because of that law’s immunity.

“It’s not like Quiznos said, ‘Do any interesting video you can,’ ” said Richard J. Leighton, a partner at Keller and Heckman who specializes in advertising and trademark law. “They provoked it, instigated it, so it may be that the consumers, in this case, are effectively their agents.”

The main legal tangle the court will evaluate is whether advertisers are exempt from the Communications Decency Act and, therefore, not entitled to the immunity that law provides to parties that present user-created content.

Subway is arguing that advertising claims are not covered by such immunity because the law explicitly says that it does not apply to intellectual property. And the catch is that intellectual property is governed by the same law that governs false advertising claims, the Lanham Act.

Quiznos responds that advertisers should not lose their immunity under the Communications Decency Act, just because advertising claims are part of the Lanham Act.

Also, Mr. Rothstein, the lawyer for Quiznos, said the consumer videos should not cause concern under the Lanham Act anyway because that law requires there to be an element of deception in the ad, and, he said, “there can’t be an element of deception if everyone knows the videos were created by consumers for the sake of entering a contest.”

Still, a win for Subway would mean that user-generated advertising contests would have to play by new rules. The sponsors of such contests could find themselves in trouble if participants insulted a competitor or made unsubstantiated claims about products, said Sam Bayard, assistant director of the Citizen Media Law Project.

Bill Blackburn, a 29-year-old who submitted a video to the Quiznos contest, said it was clear to him what Quiznos had wanted.

“You were supposed to show why Subway was the lesser of the two subs, and the whole point of it was to show a Quiznos sub dominating a Subway sub,” said Mr. Blackburn, who makes ads in Lexington, Ky., and has participated in several national ad contests. In his video, he dropped Quiznos and Subway sandwiches onto the ground, and it was Subway’s that needed “medical attention,” as he termed it.

“Quiznos led you to believe it was O.K. to do it,” Mr. Blackburn said. “It’s like mudslinging, in a sense. Like politicians slinging mud back and forth at each other. I took it that it was all fair in business.”
http://www.nytimes.com/2008/01/29/bu...ia/29adco.html





'Watermarks' Written in First Artificial Genome
Roger Highfield

The scientist attempting to create the first man-made organism scribbled his name in the first synthetic genome that he unveiled a few days ago.

A team at the J Craig Venter Institute in Rockville, Maryland, announced recently how it has successfully created the largest man-made DNA structure, the circular genetic code - genome - of an artificial bacterium as a precursor to breeding a synthetic organism in the lab.

Now a table in the online supplemental materials for the Science paper that announced the feat reveals it contained a secret message embedded in the DNA: the code carries the name of the head of the institute, Dr Craig Venter, that of his research institute and co-workers.

His name appears in the synthetic genome as one of five "watermarks," sequences of genetic code. Although the genetic alphabet only comes in four letters, the team exploited how they are grouped in units of three, called codons, and each codon is equivalent to one of 20 naturally occurring amino acids.

In this way, they could spell words using the letters for the amino acids that would be produced by the DNA code. One watermark was written "VenterInstitvte " because there is no amino acid represented by the letter "u."

The other messages were Craig Venter, the Nobel prizewinner Ham Smith, Clyde A. Hutchison III, John I. Glass and Cynthia Andrews-Pfannkoch, coauthors of the synthetic genome paper, see below.

However, this particular genome will not be used for the final fully synthetic organism and it is unclear if the team will watermark its next synthetic genome.

This is not the first time Dr Venter has personalised his work. He used his own DNA in a controversial private effort to read the entire human genetic code and finished off the job this year, marking the ultimate feat of autobiography.

The five watermarks:

CRAIGVENTER

TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

VENTERINSTITVTE

TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTA ACTAGCTAA

HAMSMITH

TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA

CINDIANDCLYDE

TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGC TAATGGGTCGAT
GTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGT TAAACATCATG

GLASSANDCLYDE

TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA
http://www.telegraph.co.uk/earth/mai...igenome101.xml





Hitting It Off, Thanks to Algorithms of Love
John Tierney

The two students in Southern California had just been introduced during an experiment to test their “interpersonal chemistry.” The man, a graduate student, dutifully asked the undergraduate woman what her major was.

“Spanish and sociology,” she said.

“Interesting,” he said. ‘‘I was a sociology major. What are you going to do with that?”

“You are just full of questions.”

“It’s true.”

“My passion has always been Spanish, the language, the culture. I love traveling and knowing new cultures and places.”

Bogart and Bacall it was not. But Gian Gonzaga, a social psychologist, could see possibilities for this couple as he watched their recorded chat on a television screen.

They were nodding and smiling in unison, and the woman stroked her hair and briefly licked her lips — positive signs of chemistry that would be duly recorded in this experiment at the new eHarmony Labs here. By comparing these results with the couple’s answers to hundreds of other questions, the researchers hoped to draw closer to a new and extremely lucrative grail — making the right match.

Once upon a time, finding a mate was considered too important to be entrusted to people under the influence of raging hormones. Their parents, sometimes assisted by astrologers and matchmakers, supervised courtship until customs changed in the West because of what was called the Romeo and Juliet revolution. Grown-ups, leave the kids alone.

But now some social scientists have rediscovered the appeal of adult supervision — provided the adults have doctorates and vast caches of psychometric data. Online matchmaking has become a boom industry as rival scientists test their algorithms for finding love.

The leading yenta is eHarmony, which pioneered the don’t-try-this-yourself approach eight years ago by refusing to let its online customers browse for their own dates. It requires them to answer a 258-question personality test and then picks potential partners. The company estimates, based on a national Harris survey it commissioned, that its matchmaking was responsible for about 2 percent of the marriages in America last year, nearly 120 weddings a day.

Another company, Perfectmatch.com, is using an algorithm designed by Pepper Schwartz, a sociologist at the University of Washington at Seattle. Match.com, which became the largest online dating service by letting people find their own partners, set up a new matchmaking service, Chemistry.com, using an algorithm created by Helen E. Fisher, an anthropologist at Rutgers who has studied the neural chemistry of people in love.

As the matchmakers compete for customers — and denigrate each other’s methodology — the battle has intrigued academic researchers who study the mating game. On the one hand, they are skeptical, because the algorithms and the results have not been published for peer review. But they also realize that these online companies give scientists a remarkable opportunity to gather enormous amounts of data and test their theories in the field. EHarmony says more than 19 million people have filled out its questionnaire.

Its algorithm was developed a decade ago by Galen Buckwalter, a psychologist who had previously been a research professor at the University of Southern California. Drawing on previous evidence that personality similarities predict happiness in a relationship, he administered hundreds of personality questions to 5,000 married couples and correlated the answers with the couples’ marital happiness, as measured by an existing instrument called the dyadic adjustment scale.

The result was an algorithm that is supposed to match people on 29 “core traits,” like social style or emotional temperament, and “vital attributes” like relationship skills. (For details: nytimes.com/tierneylab.)

“We’re not looking for clones, but our models emphasize similarities in personality and in values,” Dr. Buckwalter said. “It’s fairly common that differences can initially be appealing, but they’re not so cute after two years. If you have someone who’s Type A and real hard charging, put them with someone else like that. It’s just much easier for people to relate if they don’t have to negotiate all these differences.”

Does this method actually work? In theory, thanks to its millions of customers and their fees (up to $60 a month), eHarmony has the data and resources to conduct cutting-edge research. It has an advisory board of prominent social scientists and a new laboratory with researchers lured from academia like Dr. Gonzaga, who previously worked at a marriage-research lab at U.C.L.A.

So far, except for a presentation at a psychologists’ conference, the company has not produced much scientific evidence that its system works. It has started a longitudinal study comparing eHarmony couples with a control group, and Dr. Buckwalter says it is committed to publishing peer-reviewed research, but not the details of its algorithm. That secrecy may be a smart business move, but it makes eHarmony a target for scientific critics, not to mention its rivals.

In the battle of the matchmakers, Chemistry.com has been running commercials faulting eHarmony for refusing to match gay couples (eHarmony says it can’t because its algorithm is based on data from heterosexuals), and eHarmony asked the Better Business Bureau to stop Chemistry.com from claiming its algorithm had been scientifically validated. The bureau concurred that there was not enough evidence, and Chemistry.com agreed to stop advertising that Dr. Fisher’s method was based on “the latest science of attraction.”

Dr. Fisher now says the ruling against her last year made sense because her algorithm at that time was still a work in progress as she correlated sociological and psychological measures, as well as indicators linked to chemical systems in the brain. But now, she said, she has the evidence from Chemistry.com users to validate the method, and she plans to publish it along with the details of the algorithm.

“I believe in transparency,” she said, taking a dig at eHarmony. “I want to share my data so that I will get peer review.”

Until outside scientists have a good look at the numbers, no one can know how effective any of these algorithms are, but one thing is already clear. People aren’t so good at picking their own mates online. Researchers who studied online dating found that the customers typically ended up going out with fewer than 1 percent of the people whose profiles they studied, and that those dates often ended up being huge letdowns. The people make up impossible shopping lists for what they want in a partner, says Eli Finkel, a psychologist who studies dating at Northwestern University’s Relationships Lab.

“They think they know what they want,” Dr. Finkel said. “But meeting somebody who possesses the characteristics they claim are so important is much less inspiring than they would have predicted.”

The new matchmakers may or may not have the right formula. But their computers at least know better than to give you what you want.
http://www.nytimes.com/2008/01/29/science/29tier.html





Lenovo's Q3 to Soar, Outperform in 2008

Lenovo Group Ltd (0992.HK: Quote, Profile, Research) is set to post a doubling in quarterly earnings on strong demand from Asia, and the outlook benefits from the world's No.4 PC maker being least vulnerable among its rivals to a U.S. slowdown.

Despite worries of a sharp deceleration in technology spending, analysts say Lenovo, which bought IBM's loss-making PC arm in 2005, should fare better than Hewlett-Packard Co (HPQ.N: Quote, Profile, Research), Dell Inc (DELL.O: Quote, Profile, Research) and Acer (2353.TW: Quote, Profile, Research) because of its commanding presence in China and Asia.

"The biggest concern is the slowdown in the PC market this year, but Lenovo is best-positioned within the sector since it has the least exposure to the U.S. market," said CLSA analyst Jenny Lai. "Strong growth in China could offset the weakness in the U.S. and Europe."

Lai expects weakness in U.S. IT spending, as the United States teeters on the brink of its first recession in years, and a price war expected to hit PC makers in 2008. But demand should recover in 2009, she added.

China's largest PC maker is expected to post a profit of HK$1.01 billion (US$130 million) for the October-December period, according to five analysts surveyed by Reuters Estimates, more than double a US$57.7 million profit a year ago.

But that's slower than a tripling in net profit in the previous quarter, reflecting a winding down of IT spending across its main markets.

Lenovo racked up 22 percent growth in shipments globally in the October-December period as it rode the industry's peak buying season, but cut-throat competition ate away at margins. Rival Acer, which usurped Lenovo's global No. 3 spot in the same period, managed 60.3 percent growth.

Lenovo derived more than 40 percent of its revenue from China -- it commands a third of the world's top PC arena after the United States -- and 27 percent from the Americas in the fiscal second quarter ended September.

Ups And Downs

Daiwa Institute analyst Joseph Ho, while agreeing that a U.S. slowdown would have a greater affect on its rivals, expects Lenovo's PC shipments in the fiscal fourth quarter ending March -- typically a slow period -- to fall 22 percent from Q3.

Lenovo is expected to post a full-year net profit of HK$2.8 billion, again more than twice last year's US$161 million, according to Reuters Estimates.

Shares in Lenovo rose 18 percent from October to December, outpacing a 2.5 percent gain on the main index. But they have fallen 48 percent since early November, walloped along with the rest of the sector.

Lenovo shares trade at 15.8 times prospective earnings -- slightly pricier than Dell's 14.6 and HP's 13, according to Reuters data.

"The recent ups and downs in Lenovo's shares reflect investors' uncertainty of how serious the U.S. slowdown could be." Lai said. "It may take another one or two months before demand visibility gets better."

Lenovo itself is placing plenty of hopes on its foray into the U.S. consumer arena. It introduced its first consumer computers in the United States this month, trying to cement its footprint in a market it entered with the US$1.25 billion IBM (IBM.N: Quote, Profile, Research) deal.

But analysts said Lenovo may not see strong market share gains there until the second half of 2009.

"PC makers tend to cut price to protect their market share in a slowdown, making it relatively more difficult for Lenovo to enter the U.S. market," Lai said.

Taiwan's Acer has leap-frogged Lenovo to become the world's No. 3 PC maker -- behind Hewlett Packard and Dell -- after it bought Gateway Inc for $710 million last October, according to market researcher IDC.

Acer, whose PC shipments surged 60 percent after the Gateway purchase, held 9.6 percent of worldwide PC market in the last quarter of 2007, up from 6.9 percent a year earlier. That trumped Lenovo's 7.5 percent.

It is the third biggest vendor in the United States, while Lenovo isn't among the five biggest, according to IDC.

But Lenovo maintained its leading position in Asia excluding Japan, with nearly a fifth of the region's PC market and unit growth of 25.9 percent in the fourth quarter of 2007, IDC said.

(Editing by Edwin Chan, Editing by Ken Wills and Louise Heavens)
http://www.reuters.com/article/compa...11181720080129





Times Co. Swings to Profit
Richard Pérez-Peña

The New York Times Company reported a fourth-quarter profit of $53 million on Thursday as revenue dropped, but it continued to fare better than most of its peers across the troubled newspaper industry.

The net profit amounted to 37 cents a share, compared with a net loss of $648 million, or $4.50 a share, in the period a year earlier, when the Times Company wrote down part of the value of The Boston Globe. Overall revenue in the fourth quarter fell 7.1 percent.

At the company’s news operations, advertising revenue fell 5.6 percent for the quarter and 4.7 percent for all of 2007, when adjusted for an extra week in the 2006 fiscal year. For The New York Times media group, advertising was down 2.7 percent for the quarter and 2.2 percent for the full year.

Company reports so far point to an industry-wide drop in ad revenue, newspapers’ main source of income, of about 7 percent in 2007, one of the worst performances since World War II.

The Times Company reported increased circulation revenue, which is declining at most newspaper companies, and rising income from other sources, including About.com, which continues to grow rapidly. Revenue from continuing operations declined 1.4 percent for the year.

The company cut operating costs, adjusted for the extra week, by 0.6 percent, and projects further reductions in 2008.

Excluding special items like asset sales and write-downs, the company had earnings from continuing operations of 44 cents a share in the fourth quarter. That was down slightly from 46 cents a share in the quarter a year earlier and shy of analysts’ estimates, which averaged 48 cents.

For 2007, the Times Company reported net income of $209 million, or $1.45 a share. In 2006, it recorded a loss of $543 million, or $3.76 a share, primarily because of the $814 million write-down for The Globe.

Excluding write-downs and asset sales, and adjusting for the additional week in 2006, the company’s operating profit last year was $267 million, down from $280 million the year before.

Some large newspaper companies are more diversified than The Times Company, which sold its television stations last year. And though most of them had steeper drops in their newspaper revenue, they also have lower cost structures and continue to be much more profitable.
http://www.nytimes.com/2008/02/01/bu...cnd-times.html





Waiting for It
Rachel Donadio

For writers, few steps in the publishing process are as strange as the state of suspended animation between submitting a manuscript and seeing the book appear in stores. The sudden change in cabin pressure from writing to waiting can be jarring — and can last a very long time. “It comes as a huge shock when it happens the first time,” said the Irish writer Colm Toibin, whose first novel, “The South,” appeared in 1990, a year and a half after he turned it in. “It was all slow and strange.”

Technology may be speeding up the news cycle, but in publishing, things actually seem to be slowing down. Although publishers can turn an electronic file into a printed book in a matter of weeks — as they often do for hot political titles, name-brand authors or embargoed celebrity biographies likely to be leaked to the press — they usually take a year before releasing a book. Why so long? In a word, marketing.

“It’s not the technology that’s the problem; it’s the humans that are the problem,” said Jonathan Karp, the publisher of Twelve, which releases one title a month.

The three-martini lunch and the primacy of the Book-of-the-Month Club may be things of the past, but publishing still relies on a time-honored, time-consuming sales strategy: word of mouth.

“It’s not only buzz, it’s a product introduction — but with nothing like the advertising or marketing budget that a piece of soap would have,” said David Rosenthal, the publisher of Simon & Schuster. With the Internet and blogs, word of mouth travels more quickly today, but there’s a glut of information. To help a book break through the static, publishers have to plan months in advance.

“We live in an impatient society and have a throwaway Kleenex culture, so it takes time to get over the noise barrier,” said Nan Talese, the publisher of Nan A. Talese/Doubleday. With an established author whose work is known and sales patterns reliable, “less time is necessary,” Talese said, citing her authors Ian McEwan, Margaret Atwood and Peter Ackroyd.

Karp added, “If it’s a book by someone who people aren’t familiar with, on a subject that people don’t necessarily need to have, it will take nine months to a year for people to figure it out.”

As soon as a literary agent has sold a publisher a book, and even before it’s edited, copy-edited, proofread and indexed, the publicity wheels start turning. While writers bite their nails, the book editor tries to persuade the in-house sales representatives to get excited about the book, the sales representatives try to persuade retail buyers to get excited, and the retail buyers decide how many copies to buy and whether to feature the book in a prominent front-of-the-store display, for which publishers pay dearly. In the meantime, the publisher’s publicity department tries to persuade magazine editors and television producers to feature the book or its author around the publication date, often giving elaborate lunches and parties months in advance to drum up interest.

Chain stores like Barnes & Noble and Borders generally buy books at least six months before the publication date and know about particular titles even farther in advance. Much to the anxiety of midlist writers clamoring for attention, chain stores determine how many copies of a title to buy based on the expected media attention and the author’s previous sales record. Which is why publishers say it’s easier to sell an untested but often hyped first-time author than a second or a third novel. “It’s one of the anomalies of our business that you have to reinvent the wheel with every title, virtually,” said Laurence Kirshbaum, a literary agent and former chairman of the Time Warner Book Group.

Although digitization has made the printing and typesetting process much faster, distribution still takes time, especially in a country as big as America. (In Britain, with its smaller size and more insular literary culture, things move faster.) But once a book hits the market, the product has to move. “For all the weeks and months that go into the gestation of the book, we’re up against the so-called lettuce test once we get into the stores,” Kirshbaum said. “If we don’t get sales fast, the book wilts.”

Some stores like Target and Wal-Mart reserve room in advance for mass-market paperbacks by authors like Janet Evanovich or Nora Roberts. If an author is late with a deadline and misses the target publication date, the stores won’t have room on the shelf, since they’re expecting next month’s crop of projected best sellers. “Unless you have a major author, you probably have to wait another four to six months to publish that book,” said Matthew Shear, the publisher of St. Martin’s Press, which puts out Evanovich’s Stephanie Plum mysteries.

Like movie studios jockeying over opening dates to score huge first-weekend box office numbers, publishers often change publication dates to avoid competition for reader attention and marketing buzz. The publishers of Stephen King, John Grisham and James Patterson don’t want their books appearing at the same time, since all three hope to make No. 1 on the best-seller list.

Last year, Little, Brown & Company moved up the publication date of “Her Way,” a biography of Hillary Rodham Clinton by Don Van Natta Jr., a New York Times reporter, and Jeff Gerth, a former Times reporter, so it would appear around the same time as “A Woman in Charge,” by Carl Bernstein, published by Knopf. The Bernstein book sold more copies, though perhaps not as many as it would have without a rival book on the market. “You’re competing for retail space, you’re competing for bandwidth, you’re competing for column inches,” said Paul Bogaards, the director of publicity at Knopf. “Both books wind up suffering because readers have to make a choice.”

The same thing happened last year when two books on sushi — “The Sushi Economy,” by Sasha Issenberg (Gotham), and “The Zen of Fish,” by Trevor Corson (HarperCollins) — appeared nearly simultaneously. “You never want to get in a horse race with another book on the same subject,” said William Shinker, the president and publisher of Gotham.

Real-world events — the 9/11 attacks, the death of the pope, Hurricane Katrina — can either distract from books or provide a hook. This year, publishers are scheduling a range of titles to coincide with the Beijing Olympics, including “The Last Days of Old Beijing,” by Michael Meyer (Walker), about the destruction of old neighborhoods to make way for the Olympics, and “Wolf Totem” (Penguin Press), a novel by Jiang Rong that just won the Man Asia Literary Prize.

The presidential election in November should help move political books, but other titles may suffer. Nan Graham, the editor in chief of Scribner, said she was releasing very little fiction from July to January. “I’m never publishing a novel in the fall of an election year,” she said. “I feel bad about every single person whose novel I published in the fall of ’04 because they absolutely got no attention or no sales.” Other publishers worry that in election season it’s hard to get coverage for nonpolitical titles in book pages and on radio and television, especially “The Daily Show With Jon Stewart” and “The Colbert Report,” which have become central to publishers’ publicity strategies.

Whether it’s Comedy Central or the Internet, the same media that can call attention to a book are also drawing attention away from readers. So word of mouth is still the name of the game. “If you’re trying to explain this to someone from Mars or the Harvard Business School, they’d kind of scratch their head and say, ‘There must be a better way,’” Kirshbaum, the former Time Warner Book Group chairman, said. “But so far neither Martians nor H.B.S.-ers have solved this riddle.”
http://www.nytimes.com/2008/02/03/bo...Donadio-t.html





Study Shows eBay Buyers Save Billions
Eric Auchard

Buyers save billions of dollars each year bidding on eBay auctions, according to a new study that quantifies the benefits online consumers enjoy over and above what is derived by sellers, or eBay itself.

The independent research by two statisticians from the University of Maryland's Robert H. Smith School of Business found buyers saved $7 billion that they might have otherwise been ready to pay in a study of eBay auction behavior in 2003.

Applying the same analysis to 2004 buyer data, consumers saved $8.4 billion, said Wolfgang Jank, one author of the study. A linear projection of the research findings would mean consumers saved around $19 billion during 2007, Jank said.

The study seeks to calculate what economists call "consumer surplus" -- the difference between the top price buyers were ready to pay and what they actually ended up paying. E-commerce sites provide a treasure trove of data that allows researchers to test out theories of consumer behavior.

"Consumer surplus is usually very hard to measure," said study co-author Galit Shmueli. "The problem is that it is hard to ascertain how much a winner or a bidder or a user would have been willing to pay for a certain item."

Jank and Shmueli are associate professors of decision and information technologies at the University of Maryland. They collaborated with Ravi Bapna, an associate professor at the Indian School of Business, who generated data for the study.

The study highlights the delicate balance eBay must strike between the interests of buyers and sellers on its site.

The flip side of the same data shows that sellers leave billions on the table that they might otherwise have charged buyers by setting higher prices.

While not the focus of their research, the benefit to sellers comes from the market liquidity of selling items through eBay, the world's biggest online auction service.

At an annual conference for its sellers this week in Washington D.C., eBay is poised to introduce changes designed to make its auctions more appealing to sellers while also making it easier for consumers to find items they wish to buy.

The research examined consumer purchase data from more than 4,500 U.S. and European auctions in 2003. The $7 billion in projected savings across eBay amounts to about 30 percent of the $24 billion of total merchandise sold through eBay that year.

On eBay, winning bidders only pay the next increment above what the second highest bidder was willing to pay. The difference between each winning bid and what the buyer ends up paying amounts to consumer surplus.

EBay makes publicly available much of the aggregate data about bidding on its site. But it does not reveal data on the actual highest bids people enter in the eBay bidding system.

Instead the data was drawn from a Web venture Bapna was running at the time, called Cniper.com, which allows consumers to bid automatically in the closing minutes of auctions to help them win desired items at the lowest possible price. The statisticians adjusted their data to account for eBay bidders who place bids manually rather than via automated bids.

The group's study of the 2003 buyer data will be published in a paper entitled, "Consumer Surplus in Online Auctions" in the Journal of Information Systems Research.

"You just can't quantify this (consumer surplus) for traditional retailers -- a store clerk would never get an accurate answer by asking a customer: 'How much were you really willing to pay for this item?'" Shmueli said.

"We just pay the prices the retailers demand," she said.

(Editing by Braden Reddall)
http://www.reuters.com/article/compa...42167120080128





Semel Resigns from Yahoo Board
Jemima Kiss

Former Yahoo chief executive Terry Semel has resigned from the company's board.

Semel resigned late yesterday, just ahead of news breaking today of Microsoft's $44.6bn takeover bid for Yahoo.

He stepped aside as chief executive in June after six years in the role, and was replaced by one of the Yahoo's original co-founders, Jerry Yang.

Semel became non-executive chairman on the company's board but will now be succeeded by advertising veteran Roy Bostock.

In a statement issued overnight in the US, Yang said Semel had helped lay a firm foundation for improved financial performance at Yahoo.

"Terry Semel has been a great partner and true friend, and has played a key role in helping to grow Yahoo's business - and industry-leading audience - over the past seven years," he added.

"He has also been a tremendously valuable resource in recent months, as our new management team developed and began to execute our strategic growth plans."

The resignation will be another blow for the internet company, which has seen its shares fall over concerns about its competitiveness and agility in a market dominated by Google.

During his tenure at Yahoo, Semel oversaw the key acquisitions of photosharing site Flickr, the bookmarking tool Del.icio.us and search marketing service Overture, while the company's audience grew to more than 500 million users.

Semel joined Yahoo in 2001 from Hollywood studio Warner Bros, where he was co-chairman and co-chief executive.
http://www.guardian.co.uk/media/2008...o.digitalmedia





Yahoo! CAPTCHA Cracked.

It has been suggested before that it would be a matter of time, but now it seems official: The Yahoo! CAPTCHA is no-more. A team of Russian hackers have found a way to read the CAPTCHA with 35% accuracy. Let there be no mistake: the CAPTCHA that Yahoo! deploys is believed one of the most difficult CAPTCHA's to crack. It utilizes bended alpha numeric characters and other features you might expect from a strong CAPTCHA, and still it's easy to solve by humans. I think this is a great leap in character recognition and the death punch to the Completely Automated Public Turing test to tell Computers and Humans Apart. I have a weak believe in CAPTCHA's these days, since there will always be a way to compute something that requires human interaction. Whether it be image CAPTCHA's, audible ones or simply Javascript based CAPTCHA's.

The Russian hackers had this to say about the Yahoo! CAPTCHA:

"The CAPTCHA has a vulnerability we'll discuss later. It's not necessary to achieve high degree of accuracy when designing automated recognition software. The accuracy of 15% is enough when attacker is able to run 100.000 tries per day, taking into the consideration the price of not automated recognition – one cent per one CAPTCHA." - which seems a plausible conclusion.

The released software package shows us some inside techniques, the implementation of yahoo CAPTCHA recognition engine can be found here:

http://rapidshare.com/files/84243632...ition.rar.html

If it's gone for some reason, hook me up and i'll send you my copy.
http://www.0x000000.com/?i=502





RealPlayer Labeled 'Badware'
Brian Krebs

An industry-academia group designed to raise public awareness about software that violates fair information and privacy practices has labeled recent versions of RealPlayer video streaming software as "badware," charging that the software surreptitiously installs pop-up ad serving software as well as the Rhapsody media player engine.

Stopbadware.org issued an alert about two software titles from RealNetworks - RealPlayer 10.5 and RealPlayer 11, saying each violated the group's badware guidelines.

RP10.5 fails to alert the user that its "Message Center" feature -- which is pitched as a way to keep the user up-to-date on security patches -- will pop up ads from the system tray if the user doesn't register the application.

RealPlayer 11 earned the badware mark because it installs (as an ActiveX control) the Rhapsody Player Engine without notifying the user, the report notes. In addition, when the user uninstalls RealPlayer, the Rhapsody player is left behind.

Stopbadware is a collaboration between Harvard Law School's Berkman Center for Internet & Society and Oxford University's Oxford Internet Institute, with support from companies like Google, Lenovo, and Sun Microsystems.

Typically, Google will flag Web sites that serve applications labeled as badware, placing a link below every badware site returned in a Google search that reads: "This site may harm your computer." But they have not yet done so with RealNetwork, despite the kinds of marketing tactics described in this Stop Badware alert.

John Palfrey, executive director of the Berkman Center and a professor of Internet law at Harvard, said the RealNetworks company has a history of operating at the margins of consumer privacy issues. "What was clear to us was that [RealPlayer] 10.5 and 11 went over what was, to us, a clear line."

Palfrey said Google was unlikely to list RealMedia's site as badware, however: that classification, he noted, was generally reserved for sites that try to install unwanted or malicious software when a person merely visits the site.

Ryan Luckin, public relations manager for RealNetworks, took issue with portions of the report, saying while the company still supports 10.5, it no longer distributes it. Further, Luckin said, RP11 disables the Message Center by default. He said that RealMedia would consider changing its uninstaller to remove Rhapsody in future versions of RealPlayer, though he added that RP11 was likely to remain the default player available on its site for "a good chunk of time."

All of this may come as little surprise to anyone who has installed RealPlayer on account of some video they needed to watch that wouldn't render in any other media player, only to be pestered with constant pop-up ads that gobble up system resources.

But there are alternatives. If you just need to hear streaming Real audio, the free and excellent VLC Media Player can take care of that for you. For Windows users looking for a free alternative to render Real video content, a package called "Real Alternative" should do the trick. Real Alternative includes the codec needed to play Real video content, as well as the lightweight Media Player Classic. I have relied on this latter package to be my DVD player of choice on my main PC for the past several years now, and it works great.

Anyone else know of other alternatives for playing Real video files?
http://blog.washingtonpost.com/secur...labeled_1.html





Wishing an (Un)Happy Birthday to the Storm Worm

This week marks the one-year anniversary of the emergence of the spam-enabling Storm worm, a tenacious strain of malicious software that probably speaks more about the future of online crime than almost any other malware family circulating online today.

This chronological account from security firm Trend Micro visually sums up Storm's evolution more than I could with yet another recitation of the malware's machinations.

What I'd prefer to focus on in this post is the effect Storm had on the state of Internet security over the past year, and why we should be worried about the future.

Dmitri Alperovitch, director of intelligence analysis and hosted security for San Jose, Calif.-based Secure Computing, said federal law enforcement officials who need to know have already learned the identities of those responsible for running the Storm worm network, but that U.S. authorities have thus far been prevented from bringing those responsible to justice due to a lack of cooperation from officials in St. Petersburg, Russia, where the Storm worm authors are thought to reside. In a recent investigative series on cyber crime featured on washingtonpost.com, St. Petersburg was fingered as the host city for one of the Internet's most profligate and cyber-crime enabling operation -- the Russian Business Network.

Alperovitch blames the government of Russian President Vladimir Putin and the political influence of operatives within the Federal Security Service (the former Soviet KGB) for the protection he says is apparently afforded to cybercrime outfits such as RBN and the Storm worm gang.

"The right people now know who the Storm worm authors are," Alperovitch said. "It's incredibly hard because a lot of the FSB leadership and Putin himself originate from there, where there are a great deal of people with connections in high places."

Alperovitch believes the majority of Storm worm victims are Microsoft Windows users who for whatever reason have ignored the best advice of security professionals by not running anti-virus software and/or regularly applying software security updates. Indeed, the infection statistics seem to support that analysis. I spoke with Vincent Gullotto, head of Microsoft's security research and response team, who explained that Microsoft's "malicious software removal tool" -- shipped as part of its monthly patch updates -- has removed an average of 200,000 versions of the Storm worm from Windows systems each month since November, when the software giant first started shipping removal routines for Storm.

Interestingly, versions of the Storm worm fell from the no. 3-most-removed piece of malware back in November to no. 5 this past month, Gullotto said.

According to Trend, nearly 12,000 pieces of Storm-connected malware were unleashed online over the past year (this includes the Trojan that drops the payload, the Storm worm itself, as well as regular -- sometimes hourly -- updates pushed out to infected machines to stay a step ahead of any anti-virus software installed on the host system.) As big as Storm got this past year, Symantec's numbers help put things in a bit more perspective. Storm-related malware made up slightly more than one-quarter of one percent of all potential malicious code infections in 2007, Symantec said.

All this talk of rounding up the Storm worm author(s) reminded me of the dormant bounty program initiated by Microsoft in 2003, which was sparked by the emergence of the "Blaster" worm, a highly contagious program that spread back in the good-old-days when a majority of virus writers were still crafting their wares for fun and mischief instead of for profit. So far, Microsoft has paid out a half million bucks total -- to people who turned in the miscreants behind a Blaster variant and the author of the "Sasser" worm.

I asked Gullotto whether Microsoft had considered resurrecting the "Most Wanted" reward program for things like Storm. Gullotto said the subject has been discussed and considered, but that no final decision had been made.

But Gullotto said he suspects the cybercrime landscape has changed since those minor victories in an important way that may make it unlikely that a bounty on major virus writers would do much good. Namely, he said, it may now be more profitable -- and far less dangerous -- for those in-the-know about who's behind the latest most-wanted malware to simply keep their mouths shut than it is to turn in their erstwhile employers or overseers.

"When the bounty program was put together, it was really about finding these bad guys who were pure virus writers," Gullotto said. "That's not to say the same isn't true today, but when you have the whole money aspect injected into it, this changes the playing field and may make it a bit more difficult to track down who it might be or prove more succinctly that they wrote it."
http://blog.washingtonpost.com/secur...the_storm.html





NSA, Other Spy Agencies Enlisted in Effort to Address Cyber Vulnerability

Prepare for another heated NSA-domestic spying debate: The Bush administration issues secret directive on 8 January -- informally known as the "cyber initiative" -- expanding the intelligence community's role in monitoring Internet traffic; the goal is to protect against a rising number of attacks on federal agencies' computer systems

At times physicians do heal themselves. President George Bush signed a directive earlier this month which expands the intelligence community's role in monitoring Internet traffic to protect against a rising number of attacks on federal agencies' computer systems. The directive, the content of which is classified, authorizes the intelligence agencies, in particular the National Security Agency (NSA), to monitor the computer networks of all federal agencies -- including ones they have not previously monitored. The Washington Post's Ellen Nakashima writes that until now, the government's efforts to protect itself from cyber-attacks -- attacks launched by hackers, organized crime, foreign governments, and terrorist organizations trying to steal sensitive data, have been piecemeal. Under the new initiative, a task force headed by the Office of the Director of National Intelligence (ODNI) will coordinate efforts to identify the source of cyber-attacks against government computer systems. As part of that effort, DHS will work to protect the systems and the Pentagon will devise strategies for counterattacks against the intruders.

In the past year and a half there have attacks on networks at the State, Commerce, Defense, and DHS. U.S. officials and cyber-security experts have said Chinese Web sites were involved in several of the biggest attacks back to 2005, including some at the country's nuclear-energy labs and large defense contractors. The NSA has particular expertise in monitoring a vast, complex array of communications systems overseas. The prospect of directing thsi expertise at domestic networks is raising concerns, just as the NSA's role in the government's warrantless domestic-surveillance program has been controversial. "Agencies designed to gather intelligence on foreign entities should not be in charge of monitoring our computer systems here at home," said Representative Bennie Thompson (D-Mississippi), chairman of the House Homeland Security Committee. Lawmakers with oversight of homeland security and intelligence matters say they have pressed the administration for months for details.

The classified joint directive, signed 8 January and called the National Security Presidential Directive 54/Homeland Security Presidential Directive 23, has not been previously disclosed. Plans to expand the NSA's role in cyber-security were reported in the Baltimore Sun in September. According to congressional aides and former White House officials with knowledge of the program, the directive outlines measures collectively referred to as the "cyber initiative," aiming to secure the government's computer systems against attacks by foreign adversaries and other intruders. It will cost billions of dollars, which the White House is expected to request in its fiscal 2009 budget. "The president's directive represents a continuation of our efforts to secure government networks, protect against constant intrusion attempts, address vulnerabilities and anticipate future threats," said White House spokesman Scott Stanzel. He would not discuss the initiative's details.

Nakashima correctly notes that the initiative foreshadows a policy debate over the proper role for government as the Internet becomes more dangerous.
http://hsdailywire.com/single.php?id=5420





Fingerprint Scanning Pulled from Valley Schools

Arizona school district began to fingerprint students without notifying parents, or asking for the parents' permission; the parents rebelled, the State Senate is discussing a bill to outlaw such fingerprinting, and the school district retreated: Fingerprinting will stop, and the fingerprint database will be deleted

When Shirley Wallace found out her kids were fingerprinted at school, she got angry. “Since when does anyone have the right to fingerprint our children, especially without parents' permission?” Yesterday she received good news. “I was hoping to get a good response, but I got more than I expected.” Espiritu Community Schools in Phoenix used biometrics technology to scan the fingerprints of students. School officials argued it was a way to keep track of school lunches so they can receive federal aid. This past week, however, in a letter sent to all parents, the district states it was stopping the use of this technology. The letter states they will “yield the use of the biometrics finger scan system”. They are replacing it with student ID cards.

Fred Bellamy, a Phoenix attorney who specializes in technology law, says fingerprinting children is an invasion of privacy. “Once the data are captured no matter what kind of promises the vendor may make there is a serious risk, and I think the parents have every reason to be concerned about how this data will ultimately be used.” Fernando Ruiz, a director at the school, last month admitted they never notified the parents before taking the kids' fingerprints. Ruiz said today's change was because the smaller kids were not operating the scanner properly.

Thursday, Senator Karen Johnson submitted a bill which would make it illegal for any school to collect biometrics information from students. This includes fingerprinting, voice and facial recognition and retinal scans. Wallace hopes this news spreads to across the country, “And really make parents aware of privacy issues having to do with this type of futuristic technology.” Espiritu schools said they would delete all the information they collected for the fingerprint biometrics system.
http://hsdailywire.com/single.php?id=5437





RIAA Sees a 99.6% Capitulation Rate from Students at UT
Eric Bangeman

A couple of weeks ago, the RIAA announced that it was sending out yet another round of what it calls "prelitigation settlement letters" to colleges in the US. The latest set of letters, the twelfth to be distributed since the record labels decided to carry their legal campaign to the nation's college campuses, targeted 407 students at 18 universities. News in the University of Tennessee's student newspaper (The Daily Beacon) that the school had received two subpoenas seeking data on 42 students left us wondering how many of the students decide to pay up and avoid a legal battle.

The University of Tennessee seemed like a good place to start. Since the onset of what the RIAA calls its "college deterrence campaign" in February 2007, it has sent out a total of 4,557 prelitigation settlement letters to over 150 colleges and universities in the US. 159 of those have gone to students at the University of Tennessee. We know how many settlement letters have been sent to UT-Knoxville students and how many John Doe students have been sued. The University of Tennessee-Knoxville also cooperates with the RIAA, choosing to pass on settlement letters as a matter of course. "We pass the letters on whenever we can identify the student involved," University of Tennessee spokesperson Jay Mayfield told Ars. "We think it's very important that the students involved has as much information as possible, so we pass on the letters electronically, then follow up with a printed version."

Over half of those students—54.7 percent—apparently decided to avoid a lawsuit and settle with the record labels for at least $3,000 (netting the RIAA $261,000+ in the process). 72 students ignored the settlement letters, but the overwhelming majority of those, too, settled once a John Doe lawsuit was filed.

In fact, only a single student has chanced a court battle against with the record labels, according to the Knoxville News Sentinel. That lone holdout tried last summer to quash the subpoena served on the University of Tennessee, arguing that it violated federal privacy laws. The judge found the argument unconvincing, and the lawsuit is apparently proceeding against the unidentified student. The other 71 students have settled with the record labels, avoiding a trial and potential six-figure infringement damages.

Define success

Does the ease with which the RIAA is able to extract settlements mean that the legal campaign against college students is a success? If you're just concerned about the percentage of students that willingly settle, then it could be. "[W]hat we've found is that more students tend to settle in the prelitigation stage, saving them from increasing costs that would otherwise occur if the legal process dragged on," an RIAA spokesperson told Ars. "We think that it's in everyone's best interest, and a clear indication of the strength of the complaints that we decide to bring."

But not all schools are like the University of Tennessee, and other schools likely see different settlement rates. And some choose to fight the RIAA's tactics instead of acquiescing to the record labels' demands. In Oregon, the state Attorney General has gotten involved in the fight, fighting the RIAA's subpoenas and criticizing the RIAA's conduct. The University of Washington recently decided against passing on the letters, saying that it had no way to identify the persons behind the IP addresses fingered by the RIAA. The RIAA believes that there's "no question" that a school should forward the letters, however. "It saves the students money and saves them from a potential lawsuit if they do decide to settle early," the spokesperson told Ars.

Let's look at it from another point of view. Given that the "college deterrence campaign" has gone on for nearly a year, and the RIAA is still having to send in excess of 400 settlement letters a month, it doesn't look as though the campaign is actually deterring students from using P2P services. At some schools, in fact, clampdowns on file-sharing have only served to drive P2P activity further underground.

On the bright side, the industry is finally making its core product available in a manner that music fans find compelling. Services like Last.fm now offer free, streaming music, while the Big Four record labels have finally seen the light on DRM. "The record industry is partnering with a variety of innovative services to offer fans an extraordinary array of musical experiences and generate new business opportunities," said Jonathan Lamy, the RIAA's senior VP of communications, when the group announced the latest round of settlement letters. If only the industry had been more open to these possibilities earlier, perhaps we wouldn't be talking about the efficacy of prelitigation settlement letters today.
http://arstechnica.com/news.ars/post...inst-riaa.html





Kazaa User Appeals Feds' Novel Use of Child Porn Law to Supreme Court
David Kravets

Criminal defense lawyers say they will ask the U.S. Supreme Court to review a novel legal approach the government has begun using to win stiff mandatory prison terms for those who've downloaded child pornography from file-sharing sites.

At issue is a new interpretation of a 1986 law, amended in 2003 under the Protect Act, intended to curb child-porn advertising by imposing a mandatory 15-year prison term on anyone convicted of publishing "notice" offering to distribute kid porn across state lines.

Last year, Walter Sewell, a 43-year-old pharmacist from Missouri, was sentenced under the act to the automatic 15-year prison stretch after downloading and sharing sexually explicit images over the Kazaa file-sharing network. He was the nation's first defendant to be prosecuted under what authorities admit is an "innovative use" of the Protect Act.

"He's getting more time than people actually molesting kids," says Eric Chase, a California attorney representing Sewell. "He didn't make it. He didn't sell it. He didn't even buy it."

Last year a jury found that Sewell downloaded thousands of images of child pornography using Kazaa and made them available to others from his share folder. Chase conceded that his client is guilty of distributing child pornography, which normally carries a five-year sentence.

But he argues that sharing such files over Kazaa shouldn't qualify as advertising under the law, and therefore shouldn't be subject to the mandatory 15 years.

Last week, the 8th U.S. Circuit Court of Appeals disagreed and upheld Sewell's sentence and conviction (.pdf). On Thursday, Chase said he would ask the Supreme Court to review the case.

In its ruling, the 8th Circuit found that the "descriptive fields" identifying the files in Sewell's share folder alerted Kazaa users that he was offering such illegal material. The files were named "Pedo 12-14yr.jpg," "PBC Bro's given it to Mom&Sis" and "Underage Pornography Erotica," among others.

"It's an innovative use of the statute," said Don Ledford, a spokesman for prosecutors in the Western District of Missouri, in Kansas City. "We were the first district in the country to use the statute that way to get the 15-year mandatory minimum."

U.S. attorneys throughout the country, he said, are beginning to experiment with charging Kazaa child pornography users like Sewell. Kazaa is an open system, meaning the authorities can easily learn a user's identity from his internet protocol address by subpoenaing the internet service provider. In Sewell's case, the FBI made the case.

"Prior to the internet playing such a dominant role among pedophiles and child sexual exploiters, publishing a notice for child pornography might have meant classified advertising or a notice online in a chat room or message board offering to sell child pornography," Ledford continued. "What's innovative here is the Kazaa software itself generates that notice."

In 1986, Congress approved the statute under which Sewell was prosecuted, and it originally carried a mandatory 10-year minimum sentence. The sentence was increased in 2003 to 15 years without the possibility of parole.

The law was adopted to counter illegal smut advertising in the traditional sense. Still, even three decades ago, Congress was concerned about preventing the exchange of pornographic materials through computers.

Although Kazaa did not exist in 1986, Congress specifically mentioned one of its technological forebears, computer "bulletin boards," as being a source of an illicit child-porn trade.

In upholding the conviction, the 8th Circuit ruled Jan. 17 that "Kazaa's purpose is to allow users to download each other's files, and the purpose of the descriptive fields is to alert interested users to the content of downloadable files."

The court reiterated language from a 10th U.S. Circuit Court of Appeals decision last year, a decision often cited by the Recording Industry Association of America in its music downloading lawsuits against Kazaa file sharers.

"A Kazaa file's descriptive fields are like a roadside sign to a self-serve gas station at which the owner need not be present to distribute fuel to passing motorists," the court wrote. "No one would stop at the station without the sign telling them where the gas station is. The context of such a sign tells motorists that the owner of the station is offering to distribute fuel to them."
http://www.wired.com/politics/law/news/2008/01/kid_porn





Sex Photos Cause Political Row

An exhibition of graphic sex photos have caused a political row in a Swedish town.

Christian Democrats in Alingsås want to close down the History of Sex exhibition at the town's municipal art gallery. The Liberal Party, usually allied with the Christian Democrats, says art should not be censored.

The photos, by American photographer Andres Serrano, depict scenes including a man performing oral sex on himself and a woman clutching a horse's penis.

The controversy over the exhibition has been taken to a new level by the involvement of the neo-Nazi Nationalsocialistisk Front (NSF), which has been distributing flyers protesting against the exhibition.

"As a resident of Alingsås you are contributing to this exhibition as it is the council that is behind it. This is your tax money being used to show pornography," the NSF writes in its flyers.

The photos were previously exhibited in Lund, where they were vandalized by neo-Nazis. As in Lund, the exhibition in Alingsås is closed to children under 15 and visitors are informed about the explicit nature of the photos before entering the gallery.

Despite these measures, Christian Democrats in the town, 50 kilometres north-east of Gothenburg, are livid that the pictures are on display at all. They view the decision by the gallery to give space to the exhibition as a sign of "a remarkable lack of judgement."

In a letter to local paper Alingsås Tidning, Christian Democrats on the council have demanded the gallery "take down the pictures and end the exhibition."

"Freedom of speech - absolutely, but where is the judgment?" they ask.

Lennart Karlsson, the Christian Democrat representative on the council's culture committee, refused to give an interview to news agency TT. The Liberal chairman of the committee, Lars Lundgren, said he was keen to protect free speech:

"Politicians should not decide which pictures should be shown or which books should be read. They should stay out of it, regardless of which party they belong to."
http://www.thelocal.se/9824/20080130/





IFPI Raids Hundreds of INTERNET CAFES: 600 Cops, One Arrest
Ken Fisher

Not one to sit back after just having released its report on the state of music in 2007, the IFPI announced today that the music industry organization conducted 335 raids on Internet cafes in Brazil, making good on its threat to step up its antipiracy efforts there. The raids were conducted the first two weeks of January but are only being announced now.

The action was centered in Sao Paolo and carried out in partnership with the Associacao Anti-pirateria de Cinema e Musica (APCM), Brazil's anti-piracy lobbyists dedicated to both the music and movie business. The APCM is a bit of an oddity: the group is the result of Voltron-like combinatory powers, having been formed from the merger of independent anti-piracy groups.

According to the IFPI, the raid was a success. Some 2,339 computers were seized, and more than one million "illegal" audio tracks were found. Despite this, only one (!) arrest was made.

The raid, which consumed intense human resources, sends a message to Internet café owners in Brazil and elsewhere: we can show up and take your stuff, so you should really police your own customers better. An impressive show of police power, more than 600 Special Ops police were involved.

The IFPI said that the raids were conducted in order to combat a major font of piracy in the country. Citing an independent study, the IFPI claims that 20 percent of Brazilians head to Internet cafés for the purposes of illegally downloading and sometimes burning movies and music to disc. Late last year, the IFPI said that Brazil was one of the largest black markets in the world for entertainment goods, estimating that nearly one in two CDs and DVDs sold are bootlegs.

We contacted the MPAA to ask them how Internet café owners can steer clear of troubles, but we did not hear back by press time. Some of you out there are Internet cafe operators, and the story we hear is a common one. Locking down machines can drive customers away, and regardless, turning off mass storage devices doesn't seem to be much of an option. There are plenty of legitimate uses for burners, and the café that turns them off will only lose business to those that don't.
http://arstechnica.com/news.ars/post...ne-arrest.html





The $1,500,000.00 CD

Roundtable on Copyright Damages: "What are We Doing Here?"
Sherwin Siy

“What are we doing here?” Associate Register of Copyrights David Carson raised that very question several hours into the day-long meeting, arranged to discuss Section 104 of the PRO IP Act. To be honest, it was a question I’d been asking myself ever since the roundtable had been announced at last month’s hearing on the bill.

My problem with the provision then was that no one present at the hearing was particularly keen on it—neither the Department of Justice nor the Chamber of Commerce were pushing it particularly hard. Nor was it really clear that this provision did much good to improve the state of copyright law. It has been fairly clear that this is something that the RIAA wants—it would allow them to recover a much larger sum in statutory damages. For instance, if a 10-song album were infringed, the statutory damages would not range from $750 to $150,000, as they do today, but could be as high as $7500 to $1.5 million. (For a basic explanation and backgrounder on statutory damages and Section 104, see my last blog post.)

So the RIAA wants larger litigation recoveries. But is there a real need for that? That’s the question that we’ve been asking ourselves, and it’s the question that David Carson put to the content companies that support the provision: “To proponents of this amendment: have there been any cases, since 1976, where plaintiffs have been inadequately compensated because of the operation of this rule?”

And there really wasn’t much of a response. There are cases they think went the wrong way, sure, but they just didn’t have any examples of a situation where the operation of the current law resulted in an unjustly low statutory damages award.

On the other hand, there were at least a couple of examples as to how the section prevented further damage. Mp3.com would have gone out of business far sooner had damages in its infringement case been calculated by song, rather than by album. Launchcast, which was sued because of a dispute about the operation of its music webcasting services, had to deal with a potential $200 million liability exposure, instead of $1.5 billion, and could make settlement and litigation decision accordingly.

Moreover, the discussions at the roundtable were all taking place within the larger context of high statutory damages awards. Although the topics on the agenda were limited to very specific discussion of one part of section 504(c)(1), and further tailored to the proposed changes to it, it was hard to ignore the larger implications of statutory damages generally. This theme ran throughout the entire day’s meeting, through each of the five designated topics: (1) the origins of the provision and its purpose; (2) the interpretation of the provision and whether it was clear; (3) practical experience in dealing with the provision; (4) whether the provision was meeting its intended goals; and (5) whether it should be amended, and if so, whether Section 104 of the PRO IP Act was the right way to do it.

The first session was largely dominated by Jon Baumgarten of Proskauer Rose and Bill Patry of Google. Baumgarten, though appearing on his own behalf, has in the past represented the motion picture and content industries in a number of proceedings, and also worked at the Copyright Office. Patry, in addition to his current position at Google, has also worked at the Copyright Office and as copyright counsel to the House Judiciary Committee. In the larger-scale facts, there was no disagreement: the reason that 504(c)(1) allows one statutory damages recovery for each work was the result of a compromise in overhauling copyright law from the 1909 Act. In the 1909 Act, statutory damages were multiplied by the number of infringements committed, which could quickly lead to extremely large multipliers. In response, the Copyright Office proposed awarding only one lump sum of statutory damages for each case, regardless of the number of infringements and the number of works infringed. When the copyright bar objected to this plan as providing too small an amount of damages, the Copyright Office produced language looking much like today’s statute, with damages calculated per work, but with the limitation on compilations and derivative works.

The main dispute between Baumgarten and Patry seemed to focus on whether or not the decision made by Congress and the Copyright Office in creating 504(c)(1) was the result of a deliberate compromise, or political expediency. Baumgarten opined that the only reason that the provision existed as it was was that the drafting bodies had simply reached an impasse and went forward with a non-consensus agreement in order to deal with other parts of the complex legislation. To that end, he cited the fact that most of the discussion about the provision centered around derivative works, not compilations, and that one stakeholder’s questions regarding compilations were left unaddressed by the legislative history. Patry countered that the reports and drafts following the discussion of compilations explicitly referred to the issue of compilations, and should be read as part of the legislative intent. The presence of the compilation issue in the sessions following its discussion before the Copyright Office certainly does suggest that its inclusion was no accident, and can’t be dismissed as a legislative fluke.

After that, discussion of the provision’s interpretation centered around a number of interesting questions that have arisen about the provision from time to time, including the questions like: How do you define a compilation? What happens when a work is published on its own, and then later as a compilation? Does it matter if there are multiple authors within a single compilation, or if the owner of the copyright in the compilation? These questions were discussed at length, with frequent reference to the touchstone cases on the provision. Notably, though, there isn’t a whole lot of definitive, authoritative law on some of these points because there’s really only a handful of cases out there, mostly scattered about district courts. The question of whether the statute itself was clear wasn’t definitively answered, either, since the existence of open questions about a particular law doesn’t necessarily mean that it’s vague. More to the point, the provision hasn’t actually led to all that many open disputes, compared to other areas of the 1976 Copyright Act, in its 30 years of existence. If a lack of clarity was a reason to amend 504, it wasn’t made clear why only the last sentence of 504(c)(1) was targeted, and why Section 104 was the solution that made it clearer. After all, both potential plaintiffs and defendants noted that the uncertainties of litigation results often result in pre-trial settlements. By leaving the result of a statutory damages award within an even larger possible range, Section 104’s amendments only increase that uncertainty.

It was in the discussion on practical experiences with the law that Carson pointedly asked what the effects had been on the parties at the table. No examples of damages unjustly reduced by Section 504(c)(1) were given.

The debate then turned to the question of whether or not the statute met its intended goals. The panel began with Ed Klaris, of Conde Nast, representing the Magazine Publishers Association. The magazines’ position on this issue is particularly pertinent, since they are both prime plaintiffs and prime defendants in cases regarding compilations. On the one hand, anyone copying a single magazine is almost certainly going to be copying dozens of articles and possibly hundreds of graphics and photographs, each with a potentially different author. You’d think, because of this, that magazines would have a great incentive to want to maximize damages. Yet magazines have also been on the other side of the table, such as in Greenberg v. National Geographic, where a photographer sued the magazine for publishing archived issues in CD-ROM format. The question of whether there was an implied right for the magazine to publish the photographs in digital format was at the time still an open one, and both sides had reason to believe they were right. Though National Geographic lost the case, Klaris said, the award was based upon 4 infringing articles, and not the 64 photographs at issue. With statutory damages set at $100,000 per article, Klaris said, the current law saved National Geographic from a $6.4 million award. If the intended goal of the provision was to prevent defendants from disproportionate damages, this seems ot be another pertinent example. Despite the fact that the magazines could easily profit from the amendments of Section 104, Klaris stated that their position was that current law was best for them, both as potential plaintiffs and defendants.

After that exchange, Carson proceeded to ask several of the stakeholders to articulate how they thought that changes in technology affected this provision, or possibly rendered it obsolete. Most of the responses focused on the ease of copying and the large data storage capacities of modern digital technology—the same arguments that have been raised to support amendments to copyright law like the Digital Millennium Copyright Act and others. However, as Patry pointed out, new technology, while it changes a lot, doesn’t change everything. None of these considerations seriously changes the landscape.

In illustration of this, several of the bill proponents noted that more and more compilations were being issued by the movie and music industry, and more were being brought to market. But as Gigi and others pointed out, this undercuts their own argument. If content creators fear that the current law will encourage infringers to infringe whole compilations instead of single works, then you’d expect to see fewer compilations emerge in the years since 1976. Instead, as they themselves point, out, compilations are becoming more common—in fact, the trend seems to be towards a wider diversity of distribution channels, including new compilations alongside a la carte offerings. Nor is there any real evidence of these craft defendants who seek out compilations in order to minimize liability exposure—if digital technology has enabled more copyright infringement through the Groksters of this world, it’s hard to imagine the average file-sharer taking the time to master the legal intricacies necessary to reduce his liability from a bankrupting few million dollars from an equally-bankrupting few billion.

Throughout this whole discussion, of which I’m only recounting particular selections, talk ranged through a variety of recurring themes: the intent of the legislative compromise, the existence of large statutory damages, the fact that suing for infringement—and being sued for it—are expensive and uncertain processes. But in the end, the most pertinent question should be about section 104, since of all the possible changes people would like to make to Section 504(c)(1), or even to statutory damages generally, this is the only one actively being considered by Congress. The big question is: will Section 104 fix any of these problems? The clear answer seems to be no.

No one is disputing that small creators have their copyrights infringed, too, and that litigation is expensive. But the changes made by Section 104 are narrow enough that they hardly seem likely to help the majority of creators navigate the complex and expensive waters of litigation.

Nor would this multiplier act as a real deterrent to most copyright infringers. Those who believe they are not actually infringing copyright, and find themselves on the wrong side of a close court decision would not consider a relatively obscure provision on statutory damages and suddenly believe they are in the wrong. Nor would the casual file-sharer be any less unable to pay a multi-million dollar award, instead of one in the hundreds of thousands. And nowhere was there evidence of the “crafty defendant” who would choose to infringe based upon this perceived loophole.

Meanwhile, the provision serves to threaten those who are often charged with infringement—technology innovators and technology users who in many cases, could face much higher liability, and even more legal uncertainty. Even with judicial discretion potentially mitigating large damages awards, pressure from high potential statutory damages will always affect settlement negotiations, possibly preventing new goods and services from ever reaching the market.

Moreover, any question of proportionality has to take into account that currently, statutory damages need not be proportional to actual harm. And if a $150,000 cap per compilation of creative work doesn’t adequately compensate for harm, plaintiffs can always choose to get actual damages and the infringer’s profits instead.

These arguments, as far as I can tell, remained standing at the end of the session. Despite the existence of active questions about Section 504(c)(1), none of the problems with it would be fixed by the proposed legislation at hand. Why were we there yesterday? Hopefully, the answer is that we were there to put to rest the notion that Section 104 is at all necessary or helpful.
http://www.publicknowledge.org/node/1369





Quarter-billion dollar payouts threatened

U2 Manager Takes Internet Providers To Task
Ray Bennett

Paul McGuinness, longtime manager of rock band U2, has called on Internet service providers to immediately introduce disconnection policies to end illegal music downloads and urged governments to make sure they do.

In a passionate keynote speech delivered Monday during the International Managers Summit at the MIDEM music conference, McGuinness said it was time for artists to stand up against what he called the "shoddy, careless and downright dishonest way they have been treated in the digital age."

He spread the blame between record labels that "through lack of foresight and planning allowed a range of industries to arise that let people steal music"; Silicon Valley companies that create marvelous devices but "don't think of themselves as makers of burglary kits"; and governments who "created a thieves' charter" by agreeing that ISPs should not be responsible for what passes along their pipes.

"There's a lot of money in the music business, but it has stopped coming to the artists," McGuinness said, though he agreed that U2 long ago determined that it "would be pathetic to be great artists but not be great at business."

Decrying ISPs that hold up their hands in innocence when music is downloaded via their systems, he offered a comparison.

"If you were a magazine advertising stolen cars, handling the money for stolen cars and seeing to the delivery of stolen cars, the police would soon be at your door," he said. "That's no different to an ISP, but they say they can't do anything about it. If you steal a laptop from a store or don't pay for your broadband service, you'll soon be cut off and nicked."

To great applause from the audience of music managers, McGuinness insisted that disconnection enforcement would work. "I call on ISPs to do two things. First, protect the music, and second, to make a genuine effort to share the enormous revenues. They should share their ingenuity as well as the money. We must shame them. Their snouts have been at our trough for too long."

Later, musician Peter Gabriel added his support, agreeing that a lot of money is being made out of music by ISPs. He expressed concern, though, about blanket deals.

"The trouble with any blanket agreement is that the money doesn't tend to trickle down to the artists," he said at a news conference. "We've all been told in the past about these kinds of deals, and we never see it in our (bank) accounts. It needs to be not just verbiage. It needs to express itself in money too."

In Cannes for a banquet honoring him as MIDEM's 2008 Personality of the Year, Gabriel wore a cast on his left leg as the result of a skiing mishap. "I hit a rock," he said. "And I used to think of myself as a rock artist."
http://news.yahoo.com/s/nm/20080129/...downloading_dc





See, I Told Ya Them Damn Hippies was Gonna be Trouble
John Murrell

Like, whoa … flashback. It’s been a long time since we’ve heard the hippies blamed for anything, or at least anything new, but it turns out that they’re responsible for the downfall of the music industry, according to no less an authority than Paul McGuinness, the well-respected manager of the well-respected U2 and other artists. McGuinness, speaking at the Midem music industry trade show in France, offered a variation on the conference’s theme this year — that the industry’s business model has gone to hell and it’s someone else’s responsibility to save it, preferably Internet service providers and large tech companies (I paraphrase). Part of the reason Silicon Valley companies don’t see it that way, he said, is that their minds are still clouded by the peace-love-and-sharing ethics of their forebears. “Embedded deep down in the brilliance of those entrepreneurial, hippie values seems to be a disregard for the true value of music,” he said, which is funny because you rarely see the phrase “entrepreneurial, hippie values,” and disturbing because, like many, he confuses “value” with “price.”

The rest of McGuinness’ message was substantially less amusing. “I suggest we shift the focus of moral pressure away from the individual P2P [peer to peer] thief and on to the multibillion dollar industries that benefit from these tiny crimes — the ISPs, the telcos, the device-makers,” he said. Speaking specifically of ISPs, he added, “We must shame them into wanting to help us. Their snouts have been at our trough feeding free for too long.”

As we’ve noted, any suggestion that ISPs go beyond their role as common carriers and start examining and filtering the content of their traffic is an invitation to trouble (see “Music industry to ISPs: Check out the view from the top of this slippery slope“). As long as the pipes remain dumb, the ISPs are largely protected by from liability under the law’s “safe harbor” provisions, which McGuinness called a “thieves’ charter.” Mike Masnick at TechDirt does a good job of dismantling McGuinness’ arguments and concludes by saying, “As we’ve pointed out, just about every aspect of the industry is doing fantastically well. More money is being made on concert revenue than ever before. More artists are making music than ever before. More music is being heard than ever before. Even more musical instruments are being sold than ever before in the past. Yet, because one segment of the market (the one selling plastic discs) is unwilling to take some simple steps to change its business model, everyone else has to pay up?”
http://svextra.com/blogs/gmsv/2008/0...e_trouble.html





U2 Manager Says Google And Its Hippie Friends Should Pay The Recording Industry

from the still-haven't-found-what-i'm-looking-for... dept
Mike Masnick

While the IFPI and the RIAA have been actively pushing for ISP liability for file sharing, it appears some in the industry are taking it even further. U2's manager for 30-years, Paul McGuinness, gave a talk at the Midem conference where he blamed Silicon Valley's "hippie values" for creating the problem, and demanding that tech companies of all stripes start paying the recording industry. He's talking not only about ISPs, but also Google, Apple, Microsoft, Facebook and basically every other successful tech company. There are so many problems with this, it's difficult to know where to begin, but let's tackle a few of the quotes:

First he blames these companies who have "built multibillion dollar industries on the back of our content without paying for it."

This is a common refrain from those in struggling industries, but it's meaningless. Complementary goods are a natural for building bigger markets, but no one expects one side to pay the other just for moral reasons. The oil industry's success is built on the backs of the automobile industry, but does the automobile industry demand that oil companies have a moral obligation to pay them? Computer makers have built a multibillion dollar industry on the backs of the internet and software companies -- yet, no one says they have a moral obligation to pay those companies anything. Travel guides have built huge business based on hotels and restaurants around the globe, but does anyone think that those travel guides owe the hotels and restaurants money for doing so? Hell, the recording industry itself was built off the backs of complementary goods such as radio, yet when they paid radio stations, it was known as payola and outlawed.

These companies, McGuiness claims, need to help out "not on the basis of reluctantly sharing advertising revenue, but collecting revenue for the use and sale of our content."

Uh huh. And I guess that automobile companies should be collecting revenue for the oil companies. And, home builders should be collecting revenue for the electricity companies. And, airlines should be collecting revenue for the hotel industry. You see, these are all separate industries. They may be complementary, but it's up to each one individually to figure out the business models that work. None should be pressured into saving the other from its own missteps.

"I call on them to do two things: first, taking responsibility for protecting the music they are distributing; and second, by commercial agreements, sharing their enormous revenues with the content makers and owners."

This is beginning to sound an awful like journalists who claim that Google has a moral obligation to "share revenue" with newspapers.

He claims that what all of these companies do is the equivalent of a magazine that "was advertising stolen cars, processing payments for them and arranging delivery."

That makes for a nice soundbite but has nothing to do with reality. First there's the little problem that nothing is being stolen here, only copied. Second, none of these companies are "processing payment" for unauthorized transactions. Third, none of them are "arranging delivery." It would be like the same scenario, but blaming the guys who paved the road on which the car was driven.

"Embedded deep down in the brilliance of those entrepreneurial, hippie values seems to be a disregard for the true value of music."

First, this shows a misunderstanding about the difference between price and value. It also misunderstands the culture of Silicon Valley, which is generally more libertarian these days than "hippie."

On top of all this, McGuiness is whining about this at the same time that U2 is pulling in incredible profits, making $355 million on its last tour. You know what helped fuel some of that? The fact that a new generation of fans are learning about U2 from downloading its music for free. Not only that, since they don't have to stretch their entertainment dollars as far on buying the actual music, they can pay the exorbitant concert ticket prices that U2 is charging these days.

The problem here isn't that others are letting the recording industry languish. It's that just about every other industry has realized that there's plenty of money to be made in the music industry. As we've pointed out, just about every aspect of the industry is doing fantastically well. More money is being made on concert revenue than ever before. More artists are making music than ever before. More music is being heard than ever before. Even more musical instruments are being sold than ever before in the past. Yet, because one segment of the market (the one selling plastic discs) is unwilling to take some simple steps to change its business model, everyone else has to pay up?
http://techdirt.com/articles/20080129/014416102.shtml





Forbes.com Dubs Madonna "Cash Queen of Music"

Pop star Madonna is still the material girl, earning $72 million in a recent 12-month period to top a Forbes.com list of female singers whom the financial Web site dubbed "Cash Queens of Music."

Madonna, who rose to recording superstardom in the 1980s as the "Material Girl" after her hit song of that name, beat out Barbra Streisand, who was No. 2 with annual earnings of $60 million, and Celine Dion at $45 million, according to Forbes.com.

The Web site tracked earnings in the period from June 2006 to June 2007 and said it examined concert ticket sales, merchandise revenue, album sales and earnings from ancillary products such as clothing, perfumes and endorsements.

Rounding out the top five were Colombian singing sensation Shakira at No. 4 with $38 million and R&B singer Beyonce with $27 million.

Country music stars also did well, with Faith Hill landing in the No. 8 slot with $19 million and the Dixie Chicks at No. 9 with $18 million.

Then there was Britney Spears. For all her troubles in the past year -- a stint in rehab and a bitter custody battle with ex-husband Kevin Federline, among them -- the pop star still made No. 14 on the list, earning $8 million from royalties on old songs and sales of her perfume, Curious. Her latest album, "Blackout," was released late in 2007 after the period covered by the Forbes.com survey.

Late last year, Madonna ended her long relationship with Warner Music Group Corp and reached a recording deal with concert promoter Live Nation Inc.

(Reporting by Bob Tourtellotte, Editing by Jill Serjeant and Peter Cooney)
http://www.reuters.com/article/media...23099120080130





The Indie Singer-Harpist Who Met the Orchestra
Jon Pareles

Violence may not be the first thing that comes to mind from the pristine sound of a harp, a woman’s elfin voice and the genteel, elaborate backup of a symphony orchestra. But for Joanna Newsom, the songwriter, singer and harpist who will be performing her entire 2006 album “Ys” (pronounced ees) with the Brooklyn Philharmonic Orchestra on Thursday and Friday nights at the Brooklyn Academy of Music, “emotional violence and brutality” are at the core of the songs, from their cataclysmic lyrics to their jumpy harmonies.

Since Ms. Newsom released her debut album, “The Milk-Eyed Mender,” in 2004, her music has been labeled indie-rock, singer-songwriter ballads and freak-folk. None of those categories is an exact fit for songs that are simultaneously private whimsies and grand parables, delicate and steely, childlike and sage. Ms. Newsom, who calls herself “a music school dropout” (she attended Mills College in Oakland, Calif.), accompanies herself on harp in a self-invented style that mingles classical arpeggios with syncopations from West Africa, where griots pluck hypnotic patterns on the harplike kora.

Ms. Newsom’s Brooklyn concerts this week are an individual milestone: the last performances of a worldwide tour on which she has sung “Ys” with her band and, as often as possible, with symphony orchestras from London to Sydney to Milwaukee. Half of the Brooklyn concert will be “Ys,” while the rest will be selections from “The Milk-Eyed Mender,” and a new song or two, with her Ys Street Band.

In a telephone interview from her home in Northern California, Ms. Newsom said she was ready to give “Ys” its valedictory. “The gravity of that record for me is so massive that I need to take my head out of it, or else I can’t do the kind of work I want to do, to move on,” she said. “It kind of makes me sad to be in the world I was in when I was writing that. There’s not a lot of air in there.”

The concerts are a sign of 21st-century programming for the Brooklyn Philharmonic, which has made a point of working with songwriters like Suzanne Vega, Laurie Anderson and Antony (of Antony and the Johnsons). “It’s fun to interact with these people who are approaching music in real time, being present in the moment that it’s happening,” said Michael Christie, the Brooklyn Philharmonic’s music director, who will be conducting.

At a moment when independent-minded musicians from the Arcade Fire to Kanye West to Sufjan Stevens (who recently brought his own mini-orchestra to the Brooklyn Academy) are savoring what orchestral arrangements can do, the Brooklyn Philharmonic is eager to meet them more than halfway. Mr. Christie said that Ms. Newsom was on a “master list of artists that we’re trying to link up with” that also includes the Decemberists, Cat Power and Grizzly Bear.

“It’s very exciting for them to hear that mass of sound behind them,” Mr. Christie said. “We generally find that the artists are really anxious going in as to whether we’re going to embrace them. And then people have been so relieved. We say: ‘We’re your putty. Play with us.’ ”

Ms. Newsom’s album is named after Ys, a mythical Breton city lost in a flood. It was, from the beginning, an eccentric project: a full-length album that holds just five extended songs, from 7 to 17 minutes long.

References to upheavals, betrayals and deaths float through the lyrics on “Ys.” The songs encompass animal fables, visions of war and poetic disquisitions on the differences among a meteorite, a meteor and a meteoroid. When Ms. Newsom wrote the music, “I wanted to start with a bass line that had the same violence, that didn’t seem organic or natural in the shifts that it made,” she said. “There’s a lot of strange chromaticism.” Then, “to lace these weird global shifts together,” she came up with concise melodies rooted in folk songs, which provide some stability atop the turbulence. And to bind the simplicity and the complexity, she decided to use an orchestra.

The arrangements on “Ys” are by Van Dyke Parks, whose long pop career has included roles as a lyricist for the Beach Boys (“Heroes and Villains,” “Surf’s Up”), a songwriter with his own albums, a soundtrack composer and an arranger for, among others, Bruce Springsteen, Randy Newman, Fiona Apple and U2. Ms. Newsom had not heard of him until a friend sent her Mr. Parks’s “Song Cycle,” a hugely ambitious 1968 album with verbal imagery and orchestrations that were kaleidoscopic Americana. “It freaked me out,” Ms. Newsom said. “I already knew I wanted to work with an orchestra, and this was the first thing that I heard from someone I could imagine working with who was alive.”

Mr. Parks’s orchestrations for “Ys” respond to Ms. Newsom’s voice, dart between the harp textures, peek out of shadowy interstices and allude far and wide. Mr. Christie said: “It’s not as if, ‘O.K., here’s Artist X appearing with an orchestra, and the strings are playing one whole note after another.’ It’s a core part of her music, and it provides a significant emotional contribution to the pieces.”

For Mr. Parks and Ms. Newsom, merging orchestra and harp was a yearlong process. “A lot of what we were talking about was pretty abstract, and we had to fumble at it in the dark till we totally worked it out,” she said.

First she had to explain what she wanted. “I was cleaning house yesterday, and I found a huge list of notes which was a draft of what I wanted to send him,” she said. “There was a lot of describing an image that might not be too evident in the lyrics of that particular passage. And there were a lot of adjectives that were really over the top. It was nice of him not to make fun of me.”

She added, “He was paying a lot of attention to lyrics, to the sound of the words and how they have a relation to the timbre of the instruments, and also the meaning of the words and the vocal melody. He’s a really intuitive and a sort of wild, amazing composer.”

Ms. Newsom recorded the rhapsodic songs on “Ys” performing alone on her harp, with a soloist’s fluctuations of tempo and attack. Those subtleties had to be captured in exact notation for a studio orchestra, synchronized and blended with Ms. Newsom’s harp and voice. And when she brought the score to England for its first live performances, she and her band soon realized that what she was trying to recreate onstage was not just her songs and Mr. Parks’s arrangements, but also the sound of the album as mixed by its producer, Jim O’Rourke.

Her band’s guitarist, Ryan Francesconi, meticulously reworked all the arrangements to reflect the album: specifying dynamics, removing material that disappeared in the mix, clarifying parts to be performed onstage, where a conductor can rely on visual cues as well as notation. “There’s a lot of listening to me, looking at my feet and looking at my drummer,” Ms. Newsom said. Rehearsals, with a new ensemble in each city, have been limited and intense. “Show days are 14, 15 hours of literally playing and singing the entire time,” she said. “I haven’t done that since I was in the conservatory, and it’s pretty crazy on the brain and the heart.”

And just as in the songs themselves, there’s always a chance of disaster. “The arrangements are really complicated,” Ms. Newsom said. “We have had certain experiences where the performance felt like it was just barely holding together, with one or two almost train-wreck moments. It’s obviously terrifying to have the force of all these musicians behind you, just piling up and tangling up if something goes wrong.”
http://www.nytimes.com/2008/01/29/ar...29newsome.html





Grateful Dead to Reunite for Obama Concert
Adam Tanner

The Grateful Dead, the San Francisco cult rock band that has played at political events since the 1960s, will reunite on Monday for the first time in four years to rally support for Democratic presidential candidate Barack Obama, a spokesman said on Friday.

Band leader Jerry Garcia died in 1995. Surviving members have played together occasionally since then, most recently in 2004. On Monday, original members Mickey Hart, Phil Lesh and Bob Weir will play at a San Francisco theater a day before California's primary.

"They have agreed to reunite for this one-time-only event in order to lend support to Senator Obama leading into the crucial 'Super-Tuesday' series of primaries held on Tuesday, February 5th," the band said in a statement.

The band gained fame with its free-form psychedelic music when the counterculture movement flourished in San Francisco in the 1960s, and they attracted many loyal fans who came to be known as "Deadheads."
http://www.reuters.com/article/lifes...0080202?rpc=64





Aboriginal Archive Offers New DRM
BBC

A new method of digital rights management (DRM) which relies on a user's profile has been pioneered by Aboriginal Australians.

The Mukurtu Wumpurrarni-kari Archive has been developed by a community based in Australia's Northern Territory.

It asks every person who logs in for their name, age, sex and standing within their community.

This information then restricts what they can search for in the archive, offering a new take on DRM

Dr Kimberly Christian, who helped to develop the archive, told BBC World Service's Digital Planet programme that the need to create these profiles came from community traditions over what can and cannot be seen.

"It grew out of the Warumungu community people themselves, who were really interested in repatriating a lot of images and things that had been taken from the community," she said.

"You find this a lot in indigenous communities, not just in Australia but around the world... this really big push in these communities to get this information back and let people start looking at it and narrating it themselves."

Where to look

Dr Christian, who is an assistant professor based at Washington State University, stumbled across the idea of the archive by chance after meeting a group of missionaries who had digitally archived photos of the Warumungu community since the 1930s.

After loading them onto her laptop, she took them back to Tennant Creek and set up a slideshow - where she noticed that people turned away when certain images came up on screen.

For example, men cannot view women's rituals, and people from one community cannot view material from another without first seeking permission. Meanwhile images of the deceased cannot be viewed by their families.

Offline website

"The way people were looking at the photos was embedded in the social system that already existed in the community," she said.

"People would come in and out of the area of the screen to look when they could look."

This threw up issues surrounding how the material could be archived, as it was not only about preserving the information into a database in a traditional sense, but also how people would access it depending on their gender, their relationship to other people and where they were situated.

Dr Christen and her team of software developers came up with what is described as "a website that's not online", containing photos, digital video clips, audio files, digital reproductions of cultural artefacts and documents.

The system has also been designed with a "two-click mantra" in mind, making the content easy to access for those with low computer literacy skills.

Images are arranged in their own categories, with content tagged with restrictions.

The project believes it has established a cultural solution as well as an opportunity for Aboriginals to collate much of what was once lost. The hope of the project's designers is that as culture and traditions change, history can be rewritten and changed by people themselves.
http://news.bbc.co.uk/go/pr/fr/-/2/h...gy/7214240.stm





HD Radio Alliance Against Satellite Radio Merger
FMQB

The HD Digital Radio Alliance has filed a complaint with the FCC, officially opposing the proposed satellite radio merger. The organization reiterated its position that satellite radio receivers should also be equipped with the ability to tune in HD Radio stations as well.

In a letter sent to the FCC late last week, the Alliance again says that adding HD Radio capability to satcaster receivers should be a requirement of the merger, as should the termination of any exclusivity agreements with retailers and automakers. The Alliance adds that an XM/Sirius merger would reduce consumer choices and at this point, HD Radio "cannot be considered a competitive alternative to satellite radio." They add that a merger would also "make it more difficult for HD Radio to expand consumer choices."

The letter also goes into detail about the satcasters' relationship with automakers and says that "while XM and Sirius have already become entrenched, HD Radio is at the early stages of adoption in the most important distribution channel for...radio."

Back in December, iBiquity Digital Corp. asked the Commission to require the satcasters to incorporate HD Radio technology into all satellite radio receivers, as a requirement of the FCC's approval of the merger.
http://fmqb.com/Article.asp?id=561889





Good News in the One Million Missing iPhones
Saul Hansell

Wall Street analysts have begun to search the globe for 1.7 million lost iPhones.

Apple said that it has sold 3.75 million iPhones through the end of last year, but AT&T has activated a bit less than 2 million phones. There was a moment of panic as investors imagined more than a million unsold iPhones piled up in the stock rooms of AT&T stores.

Upon reflection, several analysts have come to the conclusion that the vast bulk of these have been bought and unlocked to use on carriers other than AT&T in the United States and on European carriers who are Apple’s partners.

I was skeptical of this, as unlocking an iPhone is rather complex and risky proposition. But as I talked to Gene Munster, of Piper Jaffray, and A.M. Sacconaghi, Jr. of Sanford C. Bernstein, who were both convinced that there is widespread buying of unlocked phones, my skepticism abated a bit.

What about people who got the phones as Christmas presents and did not get around to activating them before the end of the year, I asked.

Mr. Sacconaghi said he believes that most people who got phones as gifts activated them right away.

“Typically people activate a phone within three days, and the holiday season is when you have the most time and if you are excited about a gift,” he said.

There are not, however, 1 million people who are going to steep themselves in the art of iPhone hacking. Rather, both analysts suggested that there are organized groups of gray market dealers who are buying up iPhones, unlocking them, and reselling them, largely overseas.

Mr. Munster, in fact, dispatched spies to monitor Apple stores in New York, San Francisco, and Minneapolis, who found that some 40 percent of the phones were sold to people who purchased more than one phone at a time.

“The majority of the people who were buying more than one phone were Asian, and they were bringing small buses of people who all buy more than one phone,” he said. Mr. Munster conjectured that many of the phones are being resold into Asia. It is hard to get an iPhone there and, he said, “With the value of the dollar, the cost of the phone is much less here.”

Mr. Munster estimates that of the 1.7 million phones not activated by AT&T 350,000 were sold through Apple’s partners in Europe, 512,000 were in inventory at AT&T and the European carriers, and 838,000 were sold and unlocked. Mr. Sacconaghi figures slightly fewer phones were sold in Europe and are in inventory, leaving 1 million unlocked phones.

I called Apple’s public relations department, which, as usual, declined to comment. On its conference call with analysts earlier this month, Apple said that a significant number of phones were sold and unlocked.

On the face of it, this isn’t good news for Apple. The company receives a payment estimated to be about $15 a month, from AT&T and other carriers, for iPhone accounts that are activated. So every unlocked phone is $360 of revenue forgone over the two year life of a contract.

But there are a few reasons why we shouldn’t shed a tear for Apple on this one.

For one, it shows great demand for the iPhone, especially because Apple has not made it easy for people deal in unlocked phones. With each software update it tries to close the software loopholes that allowed previous versions to be connected to unauthorized carriers (although hackers seem to always find new unlocking methods within weeks). And it restricts the number of iPhones people can buy at any one time.

Mr. Sacconaghi said it is possible that the gray market dealers, however, have overestimated demand and have a big inventory backlog themselves.

What is more, both Mr. Munster and Mr. Sacconaghi are convinced that Apple actually makes money on the iPhone without taking into account the payments from the carriers. Mr. Munster estimates that gross profit on each iPhone is about $50. That doesn’t take into account costs like development and marketing, but it’s still amazing given the product is so new in its life cycle. (The cost of making a product tends to go down faster than its selling price.) If true, Apple’s effective profits from the iPhone, taking into account the payments from carriers, are huge even if diluted because a quarter of the phones are being unlocked.

Moreover, Apple has several ways to reduce the percentage of phones that are being unlocked. The most significant plan is simply to expand the number of countries in which it sells the phones, giving buyers in Asia and Latin America a legitimate alternative to gray market dealers. If Apple still found all this to be a significant problem, it could certainly require customers to sign up for a service plan before they left the store. And it wouldn’t be a surprise if the next generation of iPhone, which Mr. Munster expects over the summer, has even tougher ways of keeping the phones locked.
http://bits.blogs.nytimes.com/2008/0...ssing-iphones/





nuvifone: Garmin Drops a Phone into the GPS

Today in a surprise announcement in New York City, Garmin whipped out the nuvifone, a full-fledged GSM HSDPA smartphone built on its own operating system with GPS navigation at its core—but e-mail and web browsing close to its heart, and a camera built in too. No pricing or carrier announcement has been made yet, though its likeliest compatible network is AT&T given the technology. (When T-Mobile launches HSDPA, it too will be suitable, and possibly more attractive than AT&T.)

Features include:

• Google local search
• Garmin Online services - traffic, weather, fuel prices, hotel discounts, etc.
• nuvi-like navigation on the road or in pedestrian mode
• Email, text, IM functions
• Camera, video camera, MP3 and MPEG4/AAC

Garmin is promising to deliver it in the 3rd quarter, and says that while the PND market isn't dying, the cellphone is clearly a ripe opportunity. Only one problem, as quipster and NPD analyst Ross Rubin pointed out: "Hello and Welcome to nuvifone!" Damn, now I'll never get that voice out of my head.
http://gizmodo.com/350894/garmin-goe...i-with-nvifone





The True Cost of SMS Messages
Sam

I just found out that AT&T (A-fee&fee?) is raising their text message pricing. When I first signed up for AT&T 6 or so years ago it cost 10 cents to send an SMS message, and it was free to receive them.

When AT&T switched to Cingular the price of sending a message dropped to 5 cents, but they started charging for incoming texts - also 5 cents. Assuming you send a message for every message you receive, this works out at about the same price as before.

AT&T came back online and phased out the CIngular brand name, and prices were again changed. This time to 15 cents each way.

More changes have taken place that I can’t quite remember. At one point text messages were 10 cents either way, and at another point they even included MMS (multimedia messages) at the same price as SMS.

As of March SMS messages on AT&T will cost 20 cents and MMS will cost 30 cents - both to send a receive.

So let’s do some math here, and figure out how much this simple transmission is actually costing us.

A standard SMS message contains up to 140 bytes (1120 bits) of data - this takes care of the 160 characters allowed in your text message. This might not make sense at first, until you realize that SMS uses 7 - not 8 - bit characters - leaving you with 128 possible character values instead of the normal 256. So 1120bits/7bits = 160 characters.

So our total message length is about a tenth of a kilobyte (.13671875 Kbytes). In terms that the iPod generation would understand - if you had an iPod with a tenth of a kilobyte you could fit 1/4000th of a song on it. I assume here and for the rest of this article that 1 song = 4 Megabytes.

If you divide 140 (the total number of bytes available to you) by 20 (the cost per message), you find that you are paying 1 cent for every 7 bytes of data. This leaves you with a cost of $1,497.97 for the 1024Kbytes contained in a single megabyte. iPod users: It would cost you $5,991.88 to transfer - not even to buy - a single song via SMS.

By comparison, I pay $50 a month for a soft bandwidth limit of 500 gigabytes through a local ISP. That comes out to 512,000 megabytes or 10,240 megabytes to the dollar. This allows me to transfer 2,560 songs for the same price as a Junior Bacon Cheeseburger off the value menu at Wendy’s: $1. I will use this my standard measurement for the rest of this article.

So far I can make the following statements concerning the costs of bandwidth:

Cost to transfer 2560 songs:

From my ISP: $1
Via SMS messaging: $15,339,212.80

But wait, there’s more!

When calculating SMS charges, most people don’t take into consideration that the message is really being paid for twice! If I send a message to another AT&T user, I am paying to send it AND they’re paying to receive it! This should probably be illegal, but that’s for another discussion.

So how much does an SMS message actually cost? Not 20 cents - but 40 cents! This doubles all of my numbers above.

Furthermore, my above figures estimate that people actually use all 160 characters available to them. Say people on average actually only used half of that (which is still being generous) - then their price of data has again doubled from the numbers I gave above!

Making adjustments for both of the above statements, we realize that our above number isn’t even close to correct! Corrected, the comparison looks more like this:

COSTS OF TRANSFERING 2,560 MP3s:

via my ISP: $1
via SMS: $61,356,851.20

Phew! THAT is premium data! It’s no wonder that SMS texting alone is a 100 Billion dollar a year industry!

How big is that? Take all of hollywood movie box office revenues worldwide. Add all of the global music industry revenues. And add all of videogaming revenues around the world. Even all those three together, we don’t reach 100 billion.

Let’s even go more premium - how much would it cost to hand deliver data?

The U.S. Postal service is currently charging 41 cents for this privilege (hmm.. only one cent more that AT&T charges to automatically handle an SMS message). So how much written data could we send in a letter?

Google says 250 is considered the standard words per page measurement, and a sheet of paper weighs about 4.5 grams. The U.S. postal service allows your letters to weigh up to 1 ounce before charging you more, which is just over 28 grams. So you could send 6 sheets of paper, minus 1 for the envelope. If you write on both sides that gives you 2500 words (10 pages x 250 words).

According to this page, the average english word is 5 characters long. Add in a space for every word and you have 6 characters per word or 1500 characters for page for a total of 15,000 characters.

Now we are not limited in any way in the types of characters we can use, but let’s assume we are using a 256 character (8 bit) set.

Our letter therefore gives us ~14Kbytes for 41 cents. To transfer an MP3 using this method, we would be looking at about $119.95. To transfer 2,560 MP3s, that comes out to only $307,072. We would also need to take into consideration the bulk rate, but for the sake of argument (and because I don’t feel like figuring it out), let’s leave it where it’s at.

The cost would drop dramatically if we compressed the data onto, say a DVD and our cost would be something more like $1.20.

Updating our chart from above:

COSTS OF TRANSFERING 2,560 MP3s:

TCP/IP: $1
TCP/SMS: $61,356,851.20
TCP/USPS: $307,072.00 (Bits written out on paper)

So getting a SMS delivered is bit for bit 200x more expensive than getting a message hand delivered to your doorstep anywhere in the United States.

What exactly justifies making SMS messages sixty one million times more expensive than ISP data and 200x more expensive than TCP/USPS? How come technology, communication, and infrastructure is getting cheaper while the costs of SMS messages are increasing exponentially? My theory: SMS messages are transfered over air made of solid gold.

edit: A few readers pointed out that from the title, this article sounds more like it’s about the carrier’s internal cost for transmitting SMS messages. For that, we turn to an informed slashdot poster:

I know the true cost of SMS messages!

I made a paper for the univeristy some years ago. The marginal cost of a SMS is 0.

They do have a little cost/opportunity. As a matter of fact SMS messages are sent on the control channel. Initially SMS were implemented in the GSM standard as a control system, just like the ICMP protocol of the IP stack. Then NOKIA though to implement a actual instant message function using SMS. The Contol channel is the channel that your mobile listens to in order to receive calls. So for receiving a SMS a control signal is sent. Since bandwidht is somehow limited on these channels it could happen that in a situation of massive usage of texting the control channel gets saturated and normal voice protocol initiation is disrupted. To prevent this carriers nowadays apply a kind of QoS delaying SMSs until there is no risk of congestion. So we can state that the marginal cost is 0 and the cost/opportunity is also 0

Another story is for the MMSs. Their cost/opportunity is even lower since they run almost enterely on GPRS thus using most bandwidht on normal data channels. Thus a MMS with pictures sounds and maybe video SHOULD cost less than a SMS.

So you wonder, why do I pay so much for a SMS or a MMS or even a Call: after the debts for the initial hardware infrastructure have been paid by the carrier you are still paying because of market segmentation (You won’t change the carrier on the fly) and a little monopoly (Almost impossible to start a new carrier from 0).

http://gthing.net/the-true-cost-of-sms-messages/





‘White Space’ — Our Wireless Broadband Future?

The unoccupied radio spectrum between broadcast TV channels may soon become a source of low-cost, ubiquitous broadband connectivity. Earlier this month, the U.S. Federal Communications Commission began Phase II testing of prototype “white space devices” (WSDs), to determine whether they can operate without interfering with the wireless devices commonly used in homes, offices, and public locations.

WSD technology represents an interesting alternative to the as-yet unrealized combination of WiFi and WiMax for low-cost, ubiquitous broadband access.

A key advantage of the TV white space frequencies, relative to WiFI and WiMAX, is that “the characteristics that make them good for TV — their ability to cover broad areas and penetrate walls and trees — also make them advantageous for sending and receiving broadband data,” according to a Microsoft-sponsored advertisement.

Microsoft is a member of the Wireless Innovation Alliance, which is urging the FCC to approve the use of TV white space for both fixed and mobile consumer applications, such as laptops, TVs, set-top boxes, PDAs, MP3 players, printers, and digital cameras.
A little WSD history

In the fall of 2006, the FCC approved the use of TV white space for fixed broadband deployments. At that time, however, the FCC declined to approve the use of TV white space for low-power fixed and mobile personal devices pending an investigation of the potential for “harmful interference” from WSDs.

Following initial evaluations last fall, Phase II WSD testing by the FCC began on Jan. 18, 2008. The purpose of this test program is to “[assess] the interference potential of such devices and establishing appropriate requirements,” the Commission says. In the current round of tests, prototype WSDs submitted by Adaptrum, Microsoft, Motorola, and Philips, will be field-tested to evaluate their performance under real world conditions. This phase of the tests is expected to last between two and three months.

After WSD prototype tests have been completed to the FCC’s satisfaction, the Commission will set about defining a set of WSD operating rules. Once that happens, consumer electronics companies will begin moving forward in developing WSDs and bringing them to market.

Possible WSD applications

As part of the migration of U.S. TV stations to digital transmission technology, between 12 and 40 unused channels will become available in each U.S. metropolitan area in February of 2009.

The New America Foundation, a “nonprofit, post-partisan, think tank,” believes WSD technology utilizing these unused channels has the potential to “stimulate new innovations in consumer products, services, and applications.”

The Foundation lists the following key applications for WSDs:

• Rural broadband deployments — TV white space offers greater range, including the ability to pass through buildings, weather, and foliage, at lower power levels
• Public safety communications — in emergencies, the WSDs can provide auxiliary services to augment existing public safety communications
• Education and enterprise video conferencing — WSDs can increase the reliability and decrease the cost of video conferencing on college and commercial campuses
• A variety of personal consumer applications — WSDs could provide new services and applications to consumers by taking advantage of the improved signal reliability, capacity, and range of the TV broadcast spectrum
• Mesh and ad-hoc networks — WSDs can be used to implement and enhance mesh networking, resulting in numerous applications and benefits
• Security applications — WSDs can be used for video surveillance and monitoring, childcare monitoring in the home or in childcare facilities, and other security applications
• Municipal broadband access — WSDs could increase the quality of service and decrease the deployment costs for municipal wireless broadband networks
• Enhanced local coverage and communications — WSDs could enable mobile video and audio services and citizen journalism
• Enterprise networking — WSD-based wireless broadband services could enable small businesses to improve their productivity

Further info

For more information about white space technology, visit the website of the Wireless Innovation Alliance, which includes Microsoft, Google, HP, and Dell among its membership.
http://www.deviceguru.com.nyud.net:8...adband-future/





Gadgets Gab at 60 GHz

Cheap silicon transceivers broadcasting in this still unlicensed band may usher in the hi-def wireless home.

Electronic devices have been communicating over the air with ever-increasing fluency, but the growth will top out soon unless engineers can lay hands on more bandwidth.

The problem stems from the growing craze for high-definition video. Already video constitutes a huge chunk of the data flowing on the Internet, and its share is rising by the day. Vendors look forward to products that will beam high-definition video straight from your camcorder to your wide-screen television set; movie distributors plan to funnel full-length feature movies through wireless networks. To do these jobs in minutes rather than hours requires download speeds in the range of 5 gigabits per second and enough bandwidth to ensure that one download doesn't step on another one down the hall.

We can find the needed bandwidth way, way above the frequencies commonly used today, in the unlicensed territory around 60 GHz, according to an article in the February issue of IEEE Spectrum. Behzad Razavi, a professor of electrical engineering at the University of California, Los Angeles, notes that until now engineers had to use relatively inexpensive and power-hungry gallium-arsenide semiconductors to make chips that receive and transmit at those frequencies. Now, he argues, breakthroughs in the lab suggest that silicon chips are ready to take over the job, at a fraction of the cost.

One breakthrough has to do with the way antennas are built. The frequencies around 60 GHz tend to be absorbed by the air, and therefore they need to be focused carefully, using arrays of radio emitters and receivers known as adaptive antennas. Researchers have now demonstrated that they can fashion such an array on a single chip, greatly reducing the cost and the power requirements. Another advance has to do with the design of circuitry that chops the high frequencies down to size--so they can be processing at slower speeds--and then builds the result up again for transmission.

Because all of these developments can be done using the standard design for today's silicon chips, known as CMOS, the devices can, in principle, be manufactured very cheaply. When hundreds of GHz-capable chips can be salted through the electronic devices in a household or office, the network cable will at last go the way of the buggy whip.
http://www.newswise.com/articles/view/537206/?sc=swtn





Wiretapping Debate: Stop the Spying
Jackson West

As Congress resumes the debate on wiretapping legislation, People for the American Way and the Electronic Frontier Foundation (EFF) have put together Stop the Spying, a site aimed at drawing attention to legislation that would grant immunity to the telecoms for complying with illegal, warrantless wiretapping of American citizens.

People are being asked to upload photos, videos or simply to make their feelings known the old-fashioned way — by contacting their senator. AT&T and other network providers are currently facing legal action for their role in helping the National Security Agency tap communications networks (the EFF is providing legal support to the plaintiffs).

The provision to grant immunity from prosecution for previous transgressions on the part of telecoms, from the House Intelligence Committee version of the bill, is seen by Republicans and President Bush as a deal breaker. “The Congress must pass liability protection for companies believed to have assisted in the efforts to defend America,” Bush declared in Monday night’s State of the Union Address.
http://gigaom.com/2008/01/29/wiretap...op-the-spying/





Watchdog Sides with MI5 to Reject Phone-Tap Evidence
Richard Norton-Taylor

The prospect of phone-tap evidence being used in court, an issue at the heart of the dispute over proposed anti-terrorism measures, received a blow yesterday when the prime minister's eavesdropping watchdog opposed the idea.

Sir Paul Kennedy, an appeal court judge who monitors communications intercepts, said in his first official report: "I am firmly of the opinion that the benefits of any change in the law [in intercept evidence] are heavily outweighed by the disadvantages." He added: "With one exception, everyone to whom I have spoken in the course of my visits seems to be of the same opinion."

A privy council inquiry on the issue is expected to report within a month in time for the second reading of the government's latest counter-terrorism bill.

Kennedy's report revealed that more than 250,000 requests were made over a nine-month period to monitor individuals' phone calls, emails and post.

His views are significant since he sought guidance from the government's three main security and intelligence agencies - MI5, MI6, and GCHQ - as well as the Serious Organised Crime Agency, the Met's counter-terrorism command, a number of other police forces, Revenue and Customs, the Foreign Office, Home Office and Ministry of Defence.

The director of public prosecutions, most MPs, some senior police officers and human rights groups want the product of intercepts to be admissible in criminal trials. They argue that such evidence would obviate the need for lengthy detention without trial.

Anti-terrorist agencies are opposed on the grounds that it would expose their capabilities and use up valuable resources. They have not made their concerns public, but Kennedy's remarks yesterday make it quite clear what their views are.

Nearly 800 public bodies can lawfully request personal communications data. They include every police force and prison and 474 local authorities as well as the security and intelligence agencies. A total of 253,557 requests for such information were made in the last nine months of 2006, the latest figures available reveal.

The figure compares with almost 450,000 such requests made over the previous 15-month period.

Shami Chakrabarti, director of Liberty, said last night: "It beggars belief that in a nine-month period, based on these figures, the entire City of Westminster could have had their phones tapped - yet Britain remains one of the few western countries that won't allow this evidence to be used in court."

Of the latest total of requests, 1,694 were by local authorities mainly for investigations by trading standards, environmental control and housing benefit departments, according to yesterday's report.

Kennedy also said that the Wilson doctrine - the principle that the phones of MPs and peers cannot be tapped by the security services - should be abandoned.
http://www.guardian.co.uk/uk_news/st...248450,00.html





Direct-to-DVD Releases Shed Their Loser Label
Brooks Barnes

If you missed the red-carpet premiere for the latest “American Pie” movie, you are not alone. There wasn’t one. “American Pie Presents: Beta House,” the sixth film in the popular comedy series, was sent straight to DVD.

But it’s not another failed straight-to-video movie collecting dust in Blockbuster. “Beta House,” which reached stores late last month, was made specifically for a DVD release and is likely to end up more profitable for Universal Studios than some of the company’s theatrical releases. The film, which cost less than $10 million to make, is expected to sell more than a million units — in line with two previous “American Pie” installments that were produced specifically for DVD release, according to Universal. That translates to sales of about $30 million before adding revenue from rentals and the sale of distribution rights to cable networks.

Once a dumping ground for movies considered virtually unwatchable, the direct-to-DVD pipeline is becoming increasingly important to mainstream film franchises.

Hollywood’s new direct-to-DVD strategy rests on calculating a sequel’s chances at the multiplex. Three big-screen “American Pie” movies rained money on Universal, selling more than $750 million of tickets worldwide, according to Box Office Mojo. But Universal had a decision to make when it came to approving a fourth installment for a theatrical release. The third film, “American Wedding,” cost $55 million plus tens of millions more to market — far more than its predecessor. Yet its ticket sales were 28 percent lower.

In previous years, the studio would have either pulled the plug on the series or continued to serve up sequels in theaters to increasingly smaller audiences. Opting for diminished returns was typically the industry’s course — why leave money on the table? — which is how wince-inducing films like “Police Academy 6: City Under Siege” ended up at the multiplex.

But studios have realized that the power of the DVD market gives them another option. They drop everything but the franchise concepts and the titles, and hire cheaper acting talent. Add a marketing campaign of decent weight to increase the size of the audience that remains and — presto — more profit, pound for pound, than some big action flicks. Oh, and get rid of that pejorative-sounding direct-to-DVD term. Call it DVD Premiere.

“It is a reflection of how people consume media these days,” said Tom Siegrist, vice president for production of 20th Century Fox Home Entertainment. “If you approach it in a smart way, looking into your catalog of released films to see what you can build on, these things really sell.”

Universal, for example, hired a new cast and released “American Pie Presents: Band Camp” and “American Pie Presents: The Naked Mile” straight to DVD. Those did so well that “Beta House” was produced and the studio is weighing a seventh installment, though costs are rising with each release.

“The direct-to-video business was making titillating, low-quality movies to feed the rental channel,” said Craig Kornblau, the president of Universal Studios Home Entertainment. “We discovered we could keep franchises alive with made-for-DVD movies if we made them feature quality.”

The number of direct-to-DVD films has grown 36 percent since 2005 with 675 released last year, according to Adams Media Research. The business totals about $1 billion in annual sales. (All DVD sales came to $15.7 billion last year.)

Warner Brothers entered the direct-to-DVD competition a few months ago with an approach that signals how competitive the business has become. The studio thinks that making sequels and prequels of established movie brands is no longer good enough, said Diane Nelson, the president of Warner Premiere.

Instead, Ms. Nelson is trying out an array of new ideas. For instance, this summer Warner Premiere will release “Get Smarter: Bruce and Lloyd Out of Control” on DVD in conjunction with “Get Smart,” a big-screen comedy based on the 1960s television series. The projects were filmed back to back with supporting characters appearing in both. (The star of the newest “Get Smart,” Steve Carell, appears only in the bigger project.)

The quality of direct-to-DVD titles may be improving, but few movie fans will confuse these releases with what they see in theaters. For starters, few of the original stars appear. When Universal decided last fall to make a direct-to-DVD prequel to “The Scorpion King,” it replaced Dwayne Johnson, known as the Rock, with a lesser-known wrestler-turned-actor, Randy Couture.

“We weren’t going to be able to afford the Rock, but when we took a look at Randy we saw that he is actually quite good,” Mr. Kornblau said.

DVD Premiere movies are also much more explicit — full-frontal nudity is a hallmark of the “American Pie Presents” films — because they are not required to meet the same rating standards as theatrical releases. “Too graphic, too disturbing and too shocking for general audiences” is how Lionsgate describes some horror sequels in promotional material, adding that the studio had “defied the system” by sidestepping theaters.

Special effects in these films, while improving as a result of cheaper digital technology, often require a little more imagination from viewers. “Garfield” and “Dr. Dolittle” were both hits in theaters, but talking animals are expensive. John Davis, the producer behind both franchises, said the direct-to-DVD sequels of those films use less sophisticated effects.

“We feel our quality is really terrific, but a television set is a little more forgiving than a movie screen,” he said. “The mouth movements on the animals don’t need to match quite as precisely.” Mr. Davis is now working on two new direct-to-DVD installments of “Dr. Dolittle” — without Eddie Murphy — and another “Garfield.”

So many studios and top-level filmmakers are flirting with the direct-to-DVD business that it risks mirroring the troubled theatrical landscape, where movies that were once sure-fire moneymakers are having a harder time breaking through because of a glut of releases. The producer Joel Silver, known for the “Matrix” trilogy, recently signed a deal to produce 10 direct-to-DVD titles. Ashley Tisdale, a teenage actress known for her roles in Disney’s “High School Musical” blockbusters, just completed a DVD movie called “Picture This.”

“Real stars and real filmmakers have started giving DVD exclusives a shot,” said Scott Hettrick, former editor of the trade publication Video Business, “but with more product hitting store shelves I think we’re going to see less consistency in sales.”

A boom in animated direct-to-video titles in the 1990s led to similar saturation, resulting in studios like Walt Disney sharply reducing their output, Mr. Hettrick noted.

Some cast continuity from movie to movie is important, Mr. Kornblau said, which is why the “American Pie” DVD spinoffs all feature Eugene Levy as a father figure — even though the character’s son stopped appearing after the series ended its run in theaters.

“We think he is crucial to this franchise because his character represents the heart of the movie,” Mr. Kornblau said. “His presence reminds fans that we are maintaining the integrity of the franchise.” (Mr. Levy declined to be interviewed.)

One trap that studios are still learning to avoid is becoming hypnotized by a made-for-DVD movie and giving it a shot in theaters. “Daddy Day Camp,” intended as a DVD sequel to the 2003 Eddie Murphy hit “Daddy Day Care,” was received so well by test audiences that Sony gave it a shot in the big leagues last summer. It sold just $13 million in tickets.
http://www.nytimes.com/2008/01/28/bu...dia/28dvd.html





Startups Rush to Pave Way for Web Video
AP

Video on the Internet has gone from being the next big thing to the current big thing. But murky YouTube videos are just the start -- there's a lot of room for improvement. A raft of startups are rushing to supply the tools to make better and more profitable video available. Nearly a dozen video-related startups will be presenting at the DEMO 08 technology conference, starting Monday in Palm Desert, Calif.

The biannual conference, which gives startups and more established companies six minutes on stage to pitch their new products to investors and media, has been the launching pad for several successful ventures over the years, including the Java programming language, TiVo Inc. and Half.com.

Several of the 77 companies presenting this time have been tackling the problem of taking video quality to the next level. It's quite possible to send high-definition video over the Internet, but the cost of doing it at scale is daunting, because it requires about 40 times the bandwidth of a YouTube-quality video.

''If you run any infrastructure that lets people share video, it's really, really expensive,'' said Dan Putterman, chief executive of San Francisco-based Squidcast Inc.

The company is launching a service that allows users to send video they've shot with their high-definition camcorders to friends and relatives at full resolution, for free.

To do this, users will take help from other users, in a manner similar to peer-to-peer file sharing programs like BitTorrent and KaZaa. Each file that is uploaded gets distributed in small chunks among the computers of many users (who won't notice the chunks or be able to look at them). The intended recipient gets an e-mail with a link. Clicking it starts the download, which pulls the chunks together from the network of user computers like a squid pulling in its tentacles.

In other words, Squidcast itself doesn't need to devote computers or buy bandwidth to transfer user's files. It will finance the service by showing short video ads to the recipients while they download.

''If someone attempted to do this as a hosted platform they would simply go out of business,'' Putterman said. ''It can't be done and that's why it hasn't been done.''

Atlanta-based Asankya Inc. is trying to solve the same problem, but for Hollywood rather than home movies. CEO Scott Ryan puts the current cost of distributing an HD movie online at about $3. Considering movies rent for $4 to $5 and the creators have to be paid, there's no real money in it for distributors.

Asankya's solution deals with a fundamental problem of the Internet, which wasn't designed for transfers of HD-size files. Under regular Internet protocols, all the little parts that make up a file take the same route over the network, even if that path becomes congested during the transfer. Asankya's Hypermesh service, which it is previewing at the show, can send individual parts of a large file over different routes, then reassemble them in the right order.

''We just use the network much more efficiently,'' Ryan said. ''We get cost advantages out of that.''

The technology was developed by a Georgia Institute of Technology professor and uses servers placed at strategic points on the Internet in addition to information sent in by receiving computers.

The catch is that Asankya is mucking around with fairly basic networking technologies, ones that are built into operating systems. For now, receiving computers need software that only runs on Windows XP.

BitGravity Inc. is aiming for the same market, with a network of servers designed to deliver high-definition video. It launched the service three months ago, and at the show, the Burlingame, Calif., company plans to announce that it will be expanding the service to deliver live, streaming video.

Live streaming has been a ''luxury'' only the big media companies could afford, said Perry Wu, BitGravity's CEO, leaving a lot of unsatisfied demand, for instance for regional sportscasts. ''Whether its basketball or field hockey or water polo or swimming, the number of people who want to watch that in real time is tremendous.''

Demonstrations on BitGravity's Web site show high-resolution -- if slightly jerky -- video that starts almost immediately.

Two other startups, Eyealike Inc. and Visible Measures Corp., are tackling other problems close to the heart of content providers. Eyealike of Bellevue, Wash., will be demonstrating software that can scan videos submitted to Web sites to see if they contain copyright material.

Such filters are already in place, for example at YouTube, but Eyealike President Greg Heuss said the startup's product is better than the competition in that it can identify video that's had its audio stripped out or been cropped to as little as a quarter of the original frame.

Boston-based Visible Measures will be touting its service, which lets Web sites track how viewers play their videos: where they pause, what they rewind to see again. That should help the sites figure out which videos and ads that actually hold the viewers' attention, said Matt Cutler, the company's vice president of marketing.

''The challenge is: historically, no one's really known what happens after the play button is pressed,'' Cutler said. ''What we're introducing is the ability to sort of peer beyond that.''
http://www.portfolio.com/news-market...-for-web-video





TiVo Wins on Appeal; Dish Networks DVRs Could be Turned Off
Eric Bangeman

An appeals court has upheld a lower court's ruling that Dish Networks' DVRs infringe on software patents held by TiVo. In a unanimous opinion (PDF) issued earlier today, the US Court of Appeals for the Federal Circuit upheld a district court jury's verdict that DVRs made by Dish Network infringed on patent 6,233,389 for a "multimedia time warping system." The court also remanded the verdict on hardware patent infringements back to the district court for further proceedings.
Patent Office upholds key TiVo patent at issue in EchoStar lawsuit

There's more good news for TiVo: the $89.6 million damage award to TiVo was also upheld, and the court left open the possibility that the lower court could award additional damages based on the time that has elapsed since the original verdict and today's ruling. Last, and perhaps most troubling for Dish, the company faces the very real possibility that it will be barred from selling DVRs and forced to disable the functionality on devices already in customers' homes. That's because the appeals court affirmed a permanent injunction against their sale an operation and said that the stay against its enforcement will end once the appeal becomes final.

TiVo originally sued Dish Networks (formerly known as EchoStar) back in 2005. The jury's verdict against Dish came in April 2006, with the injunction issued in August 2006. Dish filed a countersuit against TiVo, but that suit was put on hold while the US Patent and Trademark Office reexamined the patents in question. This past November, the validity of the patents was reaffirmed.

With the validity of the patents, the damage award, and the jury verdict all upheld upon appeal, Dish appears to be out of options. The satellite TV provider is now faced with the unpleasant decision of whether to stop selling DVRs and shut off its DVR service, hope against hope that the Supreme Court decides to hear the case, or write an eight- or nine-figure check to TiVo to cover damages and license the patents. At this point, the latter option is Dish Network's best bet.
http://arstechnica.com/news.ars/post...urned-off.html





Gartner: Blu-Ray to Win in 2008, HD DVD Price Cuts are "Useless Resistance"
Thomas Ricker

Gartner, the fat lady of research firms, is singing HD DVD's swan song this morning. Hiroyuki Shimizu, Principal Research Analyst in Japan, says in Gartner's Semiconductor DQ Monday Report that, "Gartner believes that Toshiba's price-cutting may prolong HD DVD's life a little, but the limited line-up of film titles will inflict fatal damage on the format." He goes on to call the recent price cuts "useless resistance" in avoiding the inevitable. What's that, you coyly ask? According to Shimizu, "Gartner expects that, by the end of 2008, Blu-ray will be the winning format in the consumer market, and the war will be over." With 5 of the 7 major studios now backing Blu-ray exclusively, Gartner's certainty on the subject doesn't appear to be much of a stretch.
http://www.engadget.com/2008/01/28/g...s-are-useless/





Instant Nostalgia? Let’s Go to the Videotape
Dennis Lim

“BE KIND REWIND,” Michel Gondry’s latest adventure in high-concept whimsy, appears to take place in a parallel universe without Netflix, TiVo or iTunes. When the entire VHS inventory of an old-school video store is demagnetized, the clerks respond to the disaster not by upgrading to DVD, but by enlisting the customers to remake the films with a VHS camcorder. Not far beneath the slapstick humor and communitarian spirit of Mr. Gondry’s movie (which had its premiere at the Sundance Film Festival last week and is set to open Feb. 22) lies a strong nostalgia for a technology that revolutionized home viewing but now seems destined for the dustbin of history.

Introduced in 1976, VHS, short for Video Home System, faced the threat of extinction from the start. In its infancy it had to compete with Betamax, a format rival that preceded it by a year and that it eventually vanquished. Its dominance was tested in the ’80s by the laserdisc, the first consumer medium to use optical recording technology and not magnetic tape. But it was the arrival of the DVD in 1997 that heralded the beginning of the end for VHS.

By 2002 sales of DVDs outstripped those of VHS tapes. Rentals followed the next year. VHS and video players have since gone from ubiquitous to archaic. Manufacturers have discontinued or curtailed production of videocassette recorders. Studios no longer release titles on VHS. In the rush toward shinier digital gadgets and cleaner digital images, the passing of the last great analog invention has gone almost unnoticed. Variety ran a mock obituary in 2006 under the headline “VHS, 30, Dies of Loneliness.”

VHS still seems less easy to romanticize than many other old-media castoffs. Plenty of audiophiles attest to the rich sound of vinyl (and even embrace its crackling ambience), just as experimental filmmakers and home-movie enthusiasts appreciate the coarse grain of Super 8 film. But VHS usually triggers negative connotations: failure-to-rewind fees, fuzzed-out nth-generation dubs, chewed-up tape and — “Be Kind Rewind” provides an extreme example of this — accidental erasure. Mr. Gondry recently recalled his dismay when someone inadvertently recorded over a beloved home video that he and his friends had made as teenagers. “Maybe that’s where I got the idea to erase all the tapes,” he said in a telephone interview.

DVDs are plainly superior to videocassettes. They offer better-quality picture and sound, occupy less shelf space and are relatively indestructible. Videotape, like film, is a medium defined in part by its material mortality. Repeated use, and even the passage of time, weakens its magnetism and erodes its quality. (The eeriest song on the new Radiohead album, “In Rainbows,” is a ballad about death and technology called, fittingly, “Videotape.”) But while VHS tapes were not built to last, they changed the economics of the film industry and shaped the viewing patterns that we take for granted today. Swaths of film history became available for home consumption, as studios dug into their vaults; a movie could be watched repeatedly or at the viewer’s chosen pace. The ownership and control we now assume over our media diet originated with VHS and VCRs.

The mottled look of hand-me-down VHS has become visual shorthand for bygone kitsch (the deliberately lo-fi video for the Snoop Dogg single “Sensual Seduction,” to name a recent example). But especially for those who remember this degraded aesthetic from a formative age, it can also be taken as a sign of authenticity, said Barbara Klinger, professor of culture and communication at Indiana University, Bloomington, and the author of “Beyond the Multiplex: Cinema, New Technologies, and the Home” (University of California Press, 2006). The Week in Review is edited and published by Jack Spratts. “It has been interesting to see how fans responded to the digital refurbishments of the 2004 DVD rerelease of the original ‘Star Wars’ trilogy,” which, she said, “seemed to violate the letter and spirit of the original videocassette release.” For those disgruntled viewers, “the true experience of films is rooted in youthful encounters on ‘ancient’ formats.”

The generation that came of age in the ’80s, as the VCR was becoming a staple, is especially prone to VHS nostalgia, a manifestation of the broader retro culture that has accounted for untold hours of programming on VH1. The first movie to be subjected to a VHS makeover in “Be Kind Rewind” is the Reagan-era hit “Ghostbusters.” In the British coming-of-age comedy “Son of Rambow” (set to open here in May), a couple of preteenagers discover a bootleg copy of the Rambo film “First Blood” and decide to shoot their own amateur-video version. (“Be Kind Rewind” and “Son of Rambow” are both descendants of the ultimate fan remake, “Raiders of the Lost Ark: The Adaptation,” a shot-for-shot redux of the Spielberg blockbuster created by three teenage boys over a seven-year period in the ’80s. The story of their obsessive backyard adventure is being turned into a film by the producer Scott Rudin and the writer Daniel Clowes.)

There is also the rarer and geekier phenomenon of VCR nostalgia. Andy Hain, a software engineer in Brighton, England, maintains the Web site and “virtual museum” Total Rewind (totalrewind.org), which scrupulously charts the evolution of VCRs from prehistory to obsolescence. Pride of place is given to the 70-plus vintage video players and cameras in the collection that Mr. Hain has been building since 1993.

“It was mainly the technology that appealed to me,” he wrote in an e-mail message. “The more I discovered, the more strange and unlikely machines I came across, and I wanted to get hold of them and tinker with them. I also liked the design aspect. The early machines were very expensive and would have been proudly displayed in living rooms. They were styled like top-end hi-fi components, or in some cases like the bridge of the starship Enterprise.”

Mr. Hain prizes VCRs as quaint cultural artifacts. But there are some users, Mr. Gondry noted, who value their utilitarian simplicity. “Today new product comes so fast that sometimes the human brain doesn’t have the capacity to adapt,” he said. “I’m always having to show my mother how to use a DVD player because it’s not the same logic as a VCR. A VCR is mechanical. You get a response when you press a button. A DVD player is like a computer. You make a request, and you wait for the machine to tell you whether it’s O.K. or not to do it.”

Since they function as elegies for a departed medium, “Be Kind Rewind” and “Son of Rambow” differ substantially in tone from most other movies that have prominently featured videotapes and video technology. During its lifetime VHS often symbolized alienation and malevolence, perhaps because video quickly became the medium of choice for pornography and surveillance.

The VHS tape received one of its earliest and most memorable starring roles in “Videodrome” (1982), which merged the body-horror fixations of its director, David Cronenberg, with the techno-philosophical musings of the media guru (and fellow Canadian) Marshall McLuhan. In this supremely trippy film — an alternately funny and chilling meditation on the relationship between what we watch and who we are — VHS cassettes are bearers of deranging nightmares. The most striking image is of a fleshy, throbbing videotape being stuffed into an abdominal cavity. (Mr. Cronenberg’s “History of Violence,” incidentally, was the last film to be released on VHS in the United States, in 2005.)

Some films have exploited the ghostly quality of deteriorated video images. The “Ring” series, in both the Japanese and Hollywood incarnations, takes a cue from “Videodrome” in casting videotapes as malignant agents of infection. In David Lynch’s “Lost Highway” (1997) a couple is terrorized by creepy VHS recordings of themselves asleep in bed. Michael Haneke’s “Caché” (2005) also deals with a family that is being monitored on video, for reasons unknown. In both films the mysterious tapes seem to signify the return of the repressed.

Even when the metaphysical element is absent, the use of video as a plot point often communicates an underlying unease. In Steven Soderbergh’s “Sex, Lies and Videotape” and in the cool, cerebral dramas of Atom Egoyan (like “Family Viewing” and “Calendar”), video is the language of the emotionally blocked and sexually frustrated.

Professor Klinger, the media scholar, sees these VHS movies as “mini-documentaries that indicate how new media technologies are perceived — often anxiously.” Future generations will have no shortage of new media to document, analyze and be nostalgic about, provided the technologies stick around long enough to make an impression. “Really, VHS lasted longer than could have been expected,” said Mr. Hain, the collector. “Very few media formats can expect to match that today.”
http://www.nytimes.com/2008/01/27/movies/27lim.html





The Unavoidable Update
Roy Furchgott

WHILE people like to complain that there is nothing to watch on television, about 21 million American households may find that literally true in February 2009. On the 17th of that month, most TV stations will quit broadcasting analog TV signals over the air, and older sets will go blank.

But remarkably, half of the country does not realize a changeover is coming, according to a survey by the Cable and Telecommunications Association for Marketing.

And despite advertising that proposes cable TV as the remedy for a dark screen, cable viewers with older sets — 40 million of them, according to the Federal Communications Commission — will be given a reprieve but not immunity. Three years after the over-the-air change, cable customers with analog sets could see the same blank screen. (By that time, most analog sets would be ancient.) The picture isn’t entirely bleak for old sets. There are simple steps consumers with old TVs can take to ensure that “American Idol” is still on their screen next February.

But consumers ready to make the transition may have a hard time learning how to prepare. After seeing ads about the conversion on television, Dale Hazelton, a former creative director at a direct response marketing firm living in New Hampton, N.Y., decided he wanted to keep watching free over-the-air TV. So he replaced his 20-year-old analog TV with a digital L.C.D. screen and bought a rooftop antenna that could receive over-the-air digital signals, all for about $700.

Mr. Hazelton’s antenna pulls in more than twice as many New York metro area stations as he used to get, all of them with a digital picture and 5.1 surround sound. The picture quality? “It’s unbelievable,” he said.

He had to do his research online, because he found a lot of misinformation in stores. “I went into RadioShack to get the UHF antenna and they said, ‘If you buy this, you know it won’t work next year.’ The guy had no clue. He said, ‘When TV goes digital, you have to have cable.’ I told them, ‘You really need to learn about the stuff you’re selling.’ ”

A RadioShack spokesman, Charles Hodges, said the salesman may have been a new hire who had not received the training on digital TV that is required for all employees.

Drawing the public’s attention to the changeover has not been easy. Although government agencies, cable providers and broadcasters have promised to contribute what they say is $900 million worth of educational advertising, many people stop listening when they hear “DTV.” They think it is a sales pitch for premium cable service or for high-definition TV, said a Best Buy spokesman, Brian Lucas. “I think it’s the kind of thing that it takes four or five times before people understand it applies to them,” he said.

To receive digital signals, a TV must have a digital tuner. Digital tuners were first required in some TVs beginning in 1998, but they weren’t required in all TVs until last year. Still, sets with analog-only receivers can still be found in stores.

The first step is figuring out whether your TV has a digital receiver. If you bought your TV before 1998, it is almost certainly not digital. For any TV after that, check the manual under specifications for the tuner. If it says “ATSC,” it is digital. If it says “NTSC,” it is analog. Some TVs have both.

If you don’t have a manual, sometimes “ATSC” or “NTSC” is marked on the back of the TV. Or if your TV has a setup mode that automatically seeks channels, switch it on and see if it asks “analog or digital.” If it does, your TV is digital.

If yours is one of the 21 million American households that the Government Accountability Office says has an analog TV, you are not forced to replace it. You could buy a converter box. The government, underwriting the cost of a converter box to let analog TVs play digital broadcasts, is giving out 33.5 million $40 coupons that would reduce the price of eligible converter boxes, expected to cost $50 to $70 after the discount. (Sorry, there are no coupons for TVs.)

The perseverant consumer can download a coupon application at www.dtv2009.gov or call 888-388-2009. The hearing impaired can call 877-530-2634 for English or 866-495-1161 for Spanish. The applications may also be found in some stores and public libraries.
In focus groups, over-the-air TV viewers showed an inclination to wait until the last minute to buy converter boxes, said Todd Sedmak, a spokesman for the National Telecommunications and Information Administration, which is running the coupon program. “This older gent stuck in my mind,” Mr. Sedmak said, because he was going to wait until next year. “He said: ‘Feb. 16, I am going down to Wally World, I am buying a new TV and a new converter box.’ ” The converter would allow him to keep using the old TV.

But that gentleman risks a blank box on the 18th, unless he wants to pay full price for the converter. Coupons are limited in number, and they are first-come, first-served, up to two per household.

Also of note to procrastinators: once issued, the coupons expire in 90 days.

The converter boxes are just beginning to show up in stores, although they are still hard to find. The government says they should be available in about 15,000 outlets nationwide, and it has set up a Web site, www.dtv2009.gov/VendorSearch.aspx, to list those stores. But this week it was unable to find one within 50 miles of San Francisco or Manhattan. What about those 40 million cable TV viewers who have older analog sets? The cable companies have agreed to continue to broadcast the programs required by law in both analog and digital until 2012. The F.C.C. will reassess the agreement in 2011. It can drop the requirement at that time, keep the 2012 deadline or extend it.

There is no consensus on how the industry will handle the changeover, said Brian Dietz, spokesman for the National Cable and Telecommunications Association. People with analog sets will need a new set-top cable box. The question will be whether cable companies give them out, sell them, rent them to users or tell customers to go to a store and find their own. “It’s up to the individual carriers,” Mr. Dietz said.

Some cable companies are already making the leap to all digital, like Bend Broadband in Bend, Ore. It has committed itself to supply all qualifying customers with a converter, free through 2008. “With the digital conversion we will do, everyone will have a set-top box,” said Amy Tykeson, the chief executive of Bend Broadband. The change will free bandwidth for other services, like high-definition channels, phone and faster Internet, she said.

Verizon Fios, a fiber optic service offering pay TV, phone and high-speed Internet, stopped providing analog signals to new customers this month. For existing analog customers, that signal will be phased out. Customers can still use analog TVs with a converter box. Verizon may supply qualifying customers with one free converter and additional converters for $3.99 a month, although Sharon Cohen-Hagar, a Verizon spokeswoman, said terms of the offer were still being worked out.

Satellite service subscribers fare a bit better. Their systems are already all digital but work with analog TVs. “Our customers made the digital transition 13 years ago,” said Robert Mercer, director of public relations for DirecTV. “They are all set.”
http://www.nytimes.com/2008/01/24/te.../24basics.html





TV Showman, Once Exiled, Returns With Video Site
Brooks Barnes

One of Big Media’s most controversial executives is back after a period of quasi-forced retirement.

Stephen Chao — who was fired from a top position at the News Corporation after, in separate incidents, hiring a male stripper to disrobe at a company meeting and nearly drowning Rupert Murdoch’s dog at a party — plans to announce on Wednesday the formation of a Web video company that he hopes to build into an educational alternative to YouTube.

The site, WonderHowTo.com, aggregates how-to videos, from the mundane (like “how to tie a tie” and “how to market your lawn care business in the winter”) to the strange (“how to do Criss Angel’s vanishing toothpick trick”) and the off-color (“how to train your cat to use the toilet” and beyond).

Mr. Chao says the business melds his two primary interests: a fascination with the bizarre — he worked as a National Enquirer reporter after graduating from Harvard — and the media frontier.

“I’m a video freak and I love turning over rocks and finding stuff,” he said in a telephone interview. “What I started to notice is that there is a lot of how-to information out there that is fabulous but kind of hard to find. We set out to make it easy.”
Mr. Chao’s résumé includes high-profile stints at the News Corporation, where he helped create “America’s Most Wanted” and “Cops” for Fox. He has also logged time at various media companies run by Barry Diller. But Mr. Chao, 52 years old, is perhaps best known for one of corporate America’s most spectacular flame-outs.

In 1992, Mr. Murdoch fired Mr. Chao, considered a gifted but quirky executive, after he engaged a man to remove all of his clothes during a speech being delivered at a company management retreat. The purpose was to drive home a point about decency, but Mr. Murdoch, seated in the audience next to Dick Cheney (then the secretary of defense), was not amused. Now, after spending the better part of the last decade doing consulting work and surfing near his home in Santa Monica, Calif., Mr. Chao has returned to reinvent himself as an Internet entrepreneur.

He and his partners, which include E. W. Scripps, have already cataloged nearly 100,000 videos. Scripps’ television properties include HGTV, the Food Network, the DIY Network and the Fine Living Network.

In addition to contributing instructional segments from its vast archives, Scripps will handle advertising sales for the new company. Scripps said it would aim at niche markets like glass-blowing or leatherwork that correspond to the site’s video categories.

General Catalyst Partners, a Massachusetts venture capital firm with about $1 billion under management, is the primary investor in WonderHowTo.com. Michael Goedecke co-founded the company with Mr. Chao and will serve as chief of product and technology.

So far, the number of videos on the site is tiny compared with YouTube, but Mr. Chao says that his business model will try to sidestep legal problems. YouTube, which is owned by Google, has been sued for copyright infringement by big media companies; YouTube says that it works hard to keep copyrighted material off its site.

Mr. Chao said he would avoid the piracy sinkhole by linking to videos around the Web rather than being the host of the videos, as YouTube does. “Because I happen to come from television, I happen to believe that YouTube is guilty of copyright infringement,” he said. “I don’t want to have anything to do with that.”

The how-to field is considered one of the most promising areas in Internet video. New companies like Video Jug have popped up to mine the niche, while more entrenched players like Martha Stewart Living Omnimedia see it as a potential bonanza. Ms. Stewart’s company, for instance, has been experimenting with ways to exploit its trove of instructional clips about the domestic arts, most recently introducing a video-on-demand service. Ms. Stewart’s company is also testing something it calls the Marthapedia.

“The idea is to create a one-stop-shop place to go for any information about how to do anything,” Susan Lyne, the chief executive of Martha Stewart Living, said in her most recent conference call with analysts. “Literally millions and millions of pieces of information.”

How big is the how-to market? Mr. Chao said his research showed that instructional video just for topics like fitness, dancing, languages, auto repair and gardening generated $800 million to $1 billion annually.

Mr. Chao is an expert at getting attention, but it will be difficult to top some of his previous stunts. Once, during a party at Mr. Murdoch’s home, Mr. Chao nearly drowned his host’s purebred puppy after throwing it in a swimming pool to see if it could swim. Mr. Chao then had to jump into the pool, while in a business suit, to save it.

After parting ways with Fox, Mr. Chao spent six weeks working at a McDonald’s in Redondo Beach, Calif. He went on to head programming for USA Networks, where he helped develop the popular series “Monk.” But a fiery relationship with Mr. Diller, the head of the network, overshadowed that experience. The two executives had a hard time living down an incident when both were at Fox in which Mr. Diller hurled a videocassette at Mr. Chao with such intensity that it created a hole in the wall. Mr. Chao framed that section of the wall.

He left USA Networks in 2001 and, aside from introducing several cable networks in Latin America, he has largely spent his time with his family in Santa Monica. What made him want to return to the public eye?

“You can’t spend all your life surfing,” he said.
http://www.nytimes.com/2008/01/30/bu...ia/30chao.html





Deal to End Hollywood Writers’ Strike May Be Near
Michael Cieply

Informal talks between representatives of Hollywood’s writers and production companies eliminated the major roadblocks to a new contract, opening the prospect of a tentative agreement between the parties as early as next week, according to people who were briefed on the situation but requested anonymity because they were not authorized to speak.

A deal would end a crippling writers strike that is now entering its fourth month.

The agreement may come without renewed formal negotiations between the parties, though both sides still need to agree on specific language of key provisions. If that process goes smoothly, an agreement may be presented to the governing boards of the striking Writers Guild of America West and Writers Guild of America East by the end of next week, the people said.

The breakthrough occurred Friday after two weeks of closed-door discussions between the sides. Even if approved by leaders of the guilds, a deal would require ratification by a majority of the more than 10,000 active guild members.

Writers walked out on Nov. 5 after failing to reach a new contract with producers in months of difficult bargaining. Talks resumed briefly in December, but quickly broke off again. The latest round of talks came in the wake of a tentative contract agreement between producers and the Directors Guild of America.

That deal confronted many of the same issues that have troubled writers — including difficult questions related to pay for digital distribution of shows and movies — and paved the way for Friday’s movement toward a deal.

A final sticking point had been compensation for television programs that are streamed over the Internet after their initial broadcast. Companies were seeking a period during which they could stream such shows without paying a residual, and wanted to peg payments for a year of streaming at the $1,200 level established in the directors’ contract. Writers were seeking 1.2 percent of the distributors’ revenue from such streams as a residual. How that issue was finally resolved in the informal talks remained unclear as of Saturday afternoon.

Spokesmen for the West Coast writers guild and the Alliance of Motion Picture and Television Producers did not immediately respond to requests for comment. The sides have been operating under a news blackout.
http://www.nytimes.com/2008/02/02/bu...riters.html?hp





Miss America Gets Real



To boost sagging interest, the traditional pageant is out. A 21st century look is in.
Scott Collins

IF you're an American over 40 whose mental frequency can still tune in to Bert Parks crooning, "There she is . . . Miss America!," you may have been dismayed to learn that the organizers this year turned the once-august pageant into a reality TV show, complete with makeover consultants, videotaped "confessionals" and an Italianate mansion as posh backdrop.

At one time, news of this sort might have sparked street riots and food rationing. Prior to, say, the 1980s, the Miss America pageant was an extremely big deal, a bedrock of heartland patriotism, socioeconomic aspiration and gender-role mythology. But its cultural star has dimmed over the years, and officials are struggling to reinvent the pageant for the 21st century.

Viewers can judge the results for themselves tonight, when TLC airs "Miss America Live," which included as buildup four one-hour episodes of "Miss America: Reality Check," an unscripted series that borrowed liberally from shows like "What Not to Wear," "America's Next Top Model" and "The Bachelor," while still trying to keep the contestants' fabled purity intact (read: no VH1-style hookups allowed!).

TLC's version of the pageant itself will sorely test Miss America traditionalists, provided they still exist. The 36 contestants who don't make it as finalists, for example, will not be ushered away but will instead watch from the "American Idol"-like stage -- with the semifinalists' parents, no less -- as their former rivals jockey for the crown. (Warning: Priceless reaction shots ahead.) And one of the 16 semifinalists will be chosen by viewers of the reality show.

Heresy? Maybe, but Sam Haskell said something had to be done to rescue the Las Vegas pageant from irrelevance.

"People used to know who Miss America was," Haskell, a former top William Morris TV agent and chairman of the Miss America Organization, said in an interview earlier this month. "There are going to be a lot of people who'll think we're denigrating the pageant. I don't think we are. I think we're making it more relatable. And I pray that I'm right."

In many ways, Haskell's bet sounds logical. After all, televised pageants are reality shows. Like "Top Model," Miss America has always had a competitive structure, a merciless winnowing process and a panel of judges. The connection is so obvious that the rival Miss USA pageant, owned by Donald Trump, is famous for the dozens of contestants who've graduated to that weird brand of fame reality TV affords, on "The Amazing Race," "Fear Factor," "The Bachelor" and many other shows.

But Miss America? Can a young scholarship recipient who supposedly sums up all that's ennobling about America somehow emerge from a reality show without tarnishing her crown? As Haskell tells it, even devotees were skeptical.

"A lot of the states were very nervous about it, [saying], 'What are you going to be doing, eating bugs?' " he said of the local organizers who send contestants to the national pageant. But producers were charged with keeping the series respectable: "They wouldn't put the girls in a position where they would have to do anything that wasn't classy."

And some say that's exactly the problem. With the push into reality TV, Miss America is maybe entering an arena where she can't win. Recapping "Reality Check" earlier this month, a writer for TVGasm.com wrote: "I've decided that TLC makes the most boring reality shows ever. Take some pointers from VH1, then call me."

As Tom Weeks, vice president and entertainment director at Chicago ad firm Starcom USA, more kindly put it: "You don't watch reality programming for safe content. You watch for 'Celebrity Rehab' and other train wrecks."

Weeks said that the explosion of media in recent years has simply diluted the cultural importance of the Miss America competition. "I don't think reality programming is the answer," he said, adding that officials should "refocus and get back to the basics."

Early ratings would seem to validate that view. The first episode of "Reality Check" this month logged a respectable 1.4 million viewers, according to figures from Nielsen Media Research. But subsequent airings were not as impressive, and the show hung on to only about two-thirds of the viewers from its lead-in, "What Not to Wear."

But it'd be a mistake to write off Haskell, who knows pageants almost as well as he does TV. The native of Amory, Miss., about 30 miles from Elvis Presley's hometown of Tupelo, ran the local pageant at Ole Miss and married his college sweetheart, Mary Donnelly, who was crowned Miss Mississippi in 1977.

The couple moved to Los Angeles, where Haskell began a successful 27-year career at William Morris, eventually overseeing the TV department and representing Bill Cosby, Ray Romano and other A-list clients. But he kept a close friendship with Al Marks, then Miss America's top official, and even served as a pageant judge during the 1980s.

Shortly after he exited the agency in early 2005, Haskell said, he began hearing from board members who were concerned that the pageant was losing its way. Television ratings had declined for years. Gloria Steinem and other feminist critics had made a cottage industry out of attacking the pageant as demeaning to women. And NBC had signed a long-term deal to telecast the rival Miss USA. ABC had decided to dump the Miss America telecast, and the other broadcasters were not interested in picking the show up.
"What I think what they were really unhappy about was the regime in charge was completely resistant to any kind of change," said Haskell, now 52. Officials clung to "this whole idea of presenting Miss America as this perfect Barbie doll, America's princess."

Haskell joined the board and later became chairman. He works for no salary and insisted the nonprofit organization get lean, slicing the staff from 25 to 12. More important, he helped negotiate the deals that would protect Miss America's all-important TV platform: First on CMT, Viacom's country-music network, and then, starting this year, on Discovery Networks' TLC.

"The television show is the Miss America pageant," Haskell said in his Southern drawl. "It's the only reason people know it's still around."

But he and other officials also realized that they had to find a way to reconnect with younger viewers. "One of the reasons Miss America started to fall is because we lost the younger kids," Haskell said. "They obviously are watching the other pageants. But I don't know why they didn't watch Miss America. Maybe they thought it was their parents' pageant."

If the reality show has done nothing else, some say, at least it has exposed contestants to another way of thinking about beauty and image.

During the makeover segments, consultants encouraged the women to rethink the traditional pageant reliance on heavy makeup and gigantic hairstyles.

"The girls really had to get away from that," said Rachael Scholten, a former Miss Ohio contestant who now works with Weeks at Starcom.

That kind of reaction is what gives Haskell hope that his experiment will ultimately succeed. He reasons that the organization has a chance "to rebrand Miss America, to create an alternative to Lindsay Lohan and Britney Spears and Paris Hilton.

"Little girls today want to know what kind of shoes they're wearing, what kind of bag they're carrying, what kind of dress they're wearing, what kind of car they're driving," he said. "Why can't that be Miss America, someone with a positive image?"
http://www.calendarlive.com/tv/cl-et...0,431972.story





NFL Pulls Plug On Big-Screen Church Parties For Super Bowl
Jacqueline L. Salmon

For years, as many as 200 members of Immanuel Bible Church and their friends have gathered in the church's fellowship hall to watch the Super Bowl on its six-foot screen. The party featured hard hitting on the TV, plenty of food -- and prayer.

But this year, Immanuel's Super Bowl party is no more. After a crackdown by the National Football League on big-screen Super Bowl gatherings by churches, the Springfield church has sacked its event. Instead, church members will host parties in their homes.

Immanuel is among a number of churches in the Washington area and elsewhere that have been forced to use a new playbook to satisfy the NFL, which said that airing games at churches on large-screen TV sets violates the NFL copyright.

Ministers are not happy.

"There is a part of me that says, 'Gee, doesn't the NFL have enough money already?'" said Steve Holley, Immanuel's executive pastor. He pointed out that bars are still allowed to air the game on big-screens TV sets. "It just doesn't make sense."

The Super Bowl, the most secular of American holidays, has long been popular among churches. With parties, prayer and Christian DVDs replacing the occasionally racy halftime shows, churches use the event as a way to reach members, and potential new members, in a non-churchlike atmosphere.

"It takes people who are not coming frequently, or who have fallen away, and shows them that the church can still have some fun," said the Rev. Thomas Omholt, senior pastor of St. Paul's Lutheran Church in the District. Omholt has hosted a Super Bowl party for young adults in his home for 20 years. "We can be a little less formal."

The NFL said, however, that the copyright law on its games is long-standing and the language read at the end of each game is well known: "This telecast is copyrighted by the NFL for the private use of our audience. Any other use of this telecast or any pictures, descriptions, or accounts of the game without the NFL's consent is prohibited."

The league bans public exhibitions of its games on TV sets or screens larger than 55 inches because smaller sets limit the audience size. The section of federal copyright law giving the NFL protection over the content of its programming exempts sports bars, NFL spokesman Brian McCarthy said.

The issue came to a head last year after the NFL sent a letter to Fall Creek Baptist Church in Indianapolis, warning the church not show the Super Bowl on a giant video screen. For years, the church had held a Super Bowl party in its auditorium, attracting about 400 people and showing the game on a big screen usually reserved for hymn lyrics.

The letter "was really a disturbing thing," said Marlene Broome, a spokeswoman for the church.

The church canceled last year's party. This year, its adult Sunday school classes are having parties in homes, but Broome said church members miss the big gatherings. "Everybody really had a good time," she said.

Large Super Bowl gatherings around big-screen sets outside of homes shrink TV ratings and can affect advertising revenue, McCarthy said. "We have no objection to churches and others hosting Super Bowl parties as long as they . . . show the game on a television of the type commonly used at home," he said. "It is a matter of copyright law."

The same policy applies to all NFL games and to movie theaters, large halls and other venues with big-screen TVs, he said.

The policy has prompted some drastic downscaling. Last year, Vienna Presbyterian Church planned a party in its fellowship hall for its middle school and high school students, airing the game on its 12-foot video screen. Church leaders had hoped to use the game to draw in the teenagers, often a tough crowd to get through church doors.

"We thought we had found our magic bullet," said Barb Jones, the church's director of communication. The event was canceled, however, after the church heard about the Indianapolis case.

This year, Vienna Presbyterian plans a party for teenagers in its basement, showing the game on smaller TV sets.

Like other churches, Vienna Presbyterian will not charge admission to view the game, and it will not use the event as a fundraiser. In a testimony to the drawing power of the Super Bowl, churches do not use the Academy Awards or other high-rated televised events to evangelize.

To avoid attracting the ire of the NFL, some churches are even giving Super Bowl parties a more generic name. Broadfording Bible Brethren Church in Hagerstown will call its annual event the "Big Game Party."

The church still plans to show the game on its jumbo-size screen near the pulpit in its sanctuary. Pastor Bill Wyand said he has heard secondhand about the policy and is not sure whether screening the game via the church's video-projector system violates NFL policy. Still, he is looking nervously over his shoulder.

On the legal flip side, the NFL's big-screen ban could end up landing the league in trouble.

John Whitehead, president of the Rutherford Institute, a Charlottesville civil liberties group that focuses on religious freedom issues, is threatening to sue the NFL on behalf of an Alabama church that wants to host a big-screen Super Bowl party. He is also seeking sponsors for federal legislation to exempt churches from the ban.

"It's ridiculous," Whitehead said. "You can go into these stores now and buy 100-inch screens. The law is just outdated."
http://www.washingtonpost.com/wp-dyn...l?hpid=topnews















Until next week,

- js.



















Current Week In Review





Recent WiRs -

January 26th, January 19th, January 12th, January 5th

Jack Spratts' Week In Review is published every Friday. Submit letters, articles, press releases, comments or questions in plain text English to jackspratts (at) lycos (dot) com. Submission deadlines are Thursdays @ 1400 UTC. Please include contact info. The right to publish all remarks is reserved.


"The First Amendment rests on the assumption that the widest possible dissemination of information from diverse and antagonistic sources is essential to the welfare of the public." - Hugo Black